Gene detail

Detailed information of FUN_013156-T1 in Acropora pulchra

Genomic Location: ptg000008l:20206558...20212075
NR annotation: XP_029212628.2, F-box only protein 42-like isoform X1 [Acropora millepora]
Species Acropora pulchra · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

FUN_013156-T1

ATGGCGGACGGGAAAGGTCAAAGTACGTCAAATGAGGTACAGTGTTATTTTTCTCAAATTCCAGTGGAAATCTTGGAGAAGATTATATCTTATTTGTCGCCTTATGGAGATTTATCCGGCGCCAAACTAGTATGTCGCTTGTGGCGTGATCTGATTACCAGGATTTGCAAACAACGTGTTCAGAACTTCAACGAAGCTGTAAGGACTGGCAATCTGCGTATTCGTAATGTGTCTACTAAGTCGCGTATGTCTCCTTTACCTCGATTTTCTCATGGCTCCTGTATTGTTGGAGAAAGGATGTATATATATGGGGGCTGTTCGTCCTCTAATACGGCATTTAATGACCTTTATTTTCTGGATCTAAGAGAAAGACGTTGGATGAAGCCTTCAACCACTGGCAACCCTCCCCCTCCAAGAGAATGTGCGACTTTAGTGGTTTATGACAACAAAGATCTTCTCATATTCGGTGGCTGGTGTCAGCCAGCTAGAATGGGAATTAATTCCGTGGCAAAGTTTTTTGATGACTTGTATAGCTTTGATATTTTTACCTCTTCATGGAAATCACCTGTTATTACGACTGGAAATGACCCTCGACCCTGTAAGAGAGCTGGACATGGAGCATGTGTTCTAGATCATAAAATGGTGATATTTGGAGGGGCTCAAAGGGAGCTCAGGTTTAATGATGTATGGGTGTTGGAATTGACAAAGATGACATGGAGTTGTCCTAATATTCGAGGCAAAAAGCCCTCGGGCAGATTTGGGCATTCACAGATGGCAATAGACAATCATACCATTCTTATTCTTGGTGGGTGTGGTGGGCCAAATTTGTTATTTGGTGATGTATGGATTTTGGATACCACTAACTGGATTTGGCAGGAGATCGAAGTCAAGAACCGTCATTGGGAAGCACCGCAGTTATGGTGCCATCCAGCAGTTCGTGTTAATGACACAGTTGTCGTGTTTAGTAAACCTTGTCATCAAGGACATACTTTATCCTCAGAAGAAATAAGAGTAACTGGTCTGGATGGCTTCTTACCCATGCAGGCATTTATTCTGGATTGCAGTACAATACGATCACATTTTTCGTGCTCTTGGAAGACTCCGGCAGTAACTCTAGGTTCACCTCCTGCTACCTCATTGCATTCTGTTGTTGTTGCGAGAGGCGAAATACTGATCTTTGGTGGTATGTTTTCAAGGTGGTCAGACTCAACTCCACAAACAAGCGCGAACATAGTATCTGTCTTCTCCTCCACTTGACAATTTTTTTTATTATATTTTATTGTAATTATTTTTTTAAGATTTTTAGCTAGGTTCTGCTTGCGCTTAAGGGAGACACCAGTTCTCGTCTGTTCTCGCCAGTTGGACGGGGTTGATAATAGGATGGGTGCCAATCTGTGAAAAACACGTGGTCGTCCATCACAACTCCCTCCCTTACGACCATTGTATGTGGGCGAAAGTTTCAGTCTAAAATGACTCGAGAGTTTTTTTCCAGCTACTTCGGTTTCTCCCTTTTCTACCTGGCTGGATTGACTAAATAACTAGACTGCTAGAAGTTAGGCTGTTCGAGAAGCTATTTAAATCACAAAGACAAGTTAGATAAAGTGTATCTTTATGTTTCAATGAAAAGCAGCAGCGTGCCCATCTGCCGTGAACGCTATATTTCTCTTTTGCATGGTATGCTGAGGTTCACACTGCAAAGAGGTGCACAAGCTGGCGTGCTTTGATGCCTAGCAAACCTGAGTTGGTTTGAAGATGAGGAAATAGATACGCATTCAGTTACCCAACATTTAGGGTGATTTAATGCTTCAACAACTGACTTGTCTATTTGTGTGGTCTCTGACTACCCATTCTAAAGGCCTCTACTATTTTGTAGCTGTGTAGCCTGCCGTTGACACTGATAAGAATAATTTCGTATCAAGAGTTATTTAGCCAAATTAAACAGAACCTTGAATCATGTCGTCGAAACCACATTATTCTTCATACTTTCTAGCGGTTTTGCAAAGTTTTCGAGCTTGCTCCGTTTAATACTCAAATCTCACAAGCAACTAAATTTGCCCTGCTTCCACTCCCTTGAAACGAGTTCCATTACGCCATTATGTCG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6P3S6	F-box only protein 42 OS=Homo sapiens OX=9606 GN=FBXO42 PE=1 SV=1
Q5RDA9	F-box only protein 42 OS=Pongo abelii OX=9601 GN=FBXO42 PE=2 SV=1
Q6PDJ6	F-box only protein 42 OS=Mus musculus OX=10090 GN=Fbxo42 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006452 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13415 all species →	Kelch_3	Galactose oxidase, central domain	Repeat	Interproscan
PF13418 all species →	Kelch_4	Galactose oxidase, central domain	Repeat	Interproscan
PF12937 all species →	F-box-like	F-box-like	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR052821 all species →	Family	F-box only substrate-recognition component	Interproscan
IPR001810 all species →	Domain	F-box domain	Interproscan
IPR015915 all species →	Homologous_superfamily	Kelch-type beta propeller	Interproscan
IPR036047 all species →	Homologous_superfamily	F-box-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46432 all species →	F-BOX ONLY PROTEIN 42	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0019005 all species →	Cellular Component	SCF ubiquitin ligase complex	Interproscan
GO:1990756 all species →	Molecular Function	ubiquitin-like ligase-substrate adaptor activity	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10317	FBXO42; F-box protein 42	-	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora pulchra tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora pulchra, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →