Gene detail

Detailed information of FUN_023416-T1 in Acropora pulchra

Genomic Location: ptg000017l:7288684...7301109
NR annotation: XP_029208855.2, poly(U)-binding-splicing factor PUF60-like isoform X1 [Acropora millepora]
Species Acropora pulchra · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

FUN_023416-T1

ATGGCCGCAGTTGCAGTTGGATTACCTCCTGAGCAAAACTTAAATGGAGAGGTTGATAAATTATCTGAAGACAAAACAAACAGTGAAATTGATGGTAATCAGAGAAGGCGGCGGAAGAGAGGTTTTGATGTTGGGCCAGGTGAAGATTCCTCTGCATCAAATGCTATGAATGGTGACGTGGAAGACCAACCCATTGATGATGGATCAAAAGGAGAACTTGTCATTGGACCAGGGGCAGGTGGCATGCAGCCACGCCCTTCAGAAGTCAAAAGAGCATTGCCCCCTCTTACTTATCAACAAGAGGAAATGCTAAAGAAAGCAAAACGATATGCAATGGAACAATCTGTTCAGCAGGTTTTGGCCAAACAGCAAGCCCTTCAGCAGCAACAGATGTCTGCATTACAGTCAGCTGCTCAGAGACAGAGAGCGTTAGCTCTCATGTGCAGGGTCTATGTTGGAAGCATCAACTTTGAGCTCCGTGAAGAGCATGTTCGACAAGCATTCCTTCCTTTTGGTCCTATAAAGAAAATTGACTTGTCATGGGACCCACTCACCATGAAACACAAGGGATTTGCCTTTGTAGAGTATGATCTACCAGAAGCAGCTCAACTTGCCTTGGAGCAAATGAATGGTGTACTCCTTGGTGGAAGAAATATCAAAGTTGGACGTCCAAGTAATGTCCCACAGGCAGCGCCATTAATTGAACAATTTGAGCAAGAAGCCAAAAAATATGCAAGAATTTATGTCGCTTCAGTGCACCCTGATTTGGCTGAAGATGACATCAAGAGTGTATTTGAGGCCTTTGGCAGAGTGAAAAGCTGTACTCTAGCCCCCGACACCATGCCAGGAAAGCACAAGGGCTATGGTTTCCTAGAATATGAAAACCAGCAGTCAGCTACAGATGCCATCGCCTCAATGAATTTGTTTGATCTCGGGGGACAGTATTTGAGAGTTGGGCGAGCCATTACACCGCCAGCTTCAGCACAAAGTAGCAATGGCACTCTGCCACCTGCCGCGGCTATGGCTGCTGCCGCAGTGTCAGCAAAGATCCAAGCTCAAGAACAGGGACTGACAAGTACATTTCCTGCTATCACCATTGCTGGTAGCACTGTGATAACATCTCTTGTTGGTACAGCTGGTCTGGTTGCTTTACCAACTATGGCCGCAGGAACTCTGGCACCTGGTGTGATGTCAACTAGTATTGCTGCACAGCCTATTATGACATCCACAGCATTATTGGCAGGAACTCCAACGGCAGTGGTTGCACCTATCTCTGCCACACCTGTGGTGACAACCACAGGGGTCCCAGTTCAACCTGCTGCTGTTCAGCAGTTGCAACTTCAACAACAACAACTCCAGCAACAGCAGTTACAGCAACAACAGTTGCAACAGCAGCAGCTGCAGCAGCAATCAGTACAAGTCATTGCTGCTCAGCAGGCTGAGGTGCGTGCAAAGATAGAGGAAGAAACGCAGAAAAAGATTGCAGAGAGCAGCATTAGTCATGAGGAGAACATGTCAATATCTGGTAGCAATGCAAGATACATGGTCATGCAGAAACTCTCTCGCAAAAGTGAGTCTAAGGTACTTGTACTTCGTAACATGGTGGGAGTAGAGGATTTAGATGAAGACCTTGAACATGAAGTTACAGATGAATGCAGCAAATTTGGGGCAGTCAGCAGAGTTGTTATCTACAATGAAAAGCAAGGCGAAGAAGAGGATGCTGAAGTTATTGTTAAAATATTTGTGGAATTTTCTCAACCTGCAGAGGCTGAAAAGGCAGCCAGTGCACTCAGTGGCCGCTGGTTTGGAGGCCGTGTGATCAAAGCAGAGCCTTATGATGAACTCAAATTTGGTGGAGGCGATTTATCAGGATAATGCTAGAGGTTGTGGAAACAAGATTGCTAACATGACGAAGCTTTGATCTTTGACAAACTCATTGATTATTGGTAGTATATGCCAGTATTTGGTTTGTGAAATACGGTAGTTTGAGAAGATTCATTTCTTGATTTAAGTGAAAGAAAAAGACCTTGTTGATCCTTATATTAGAGTTAATACAGTATTTCAAATTCAAAGTTGATATACTAGTCGATAGGAGGGTGTACTCTTTTTCAATAATTTATATTACTAGTGGTCCTACAGTGTTCTTTTTGTTCGATTTACCACACCATTGTAGAAGATTTAGAGTTCTTTTCCCTGGTACTCATTAGGGAGCATAGACAATAACAACTGCAATGAGGAAAAATGCTAATTATTGTGCTGCATACTTCTTTACTTTGACATTCTGTGAAAAAAACAACCTGTAGAAGATGTCAAAAGGTTACCTTTTTCTGTAATTTCTAATCTAGTCAGTTCTCATTTTGTATTTTGAATGATATGAAACTTATGTTTTGGAGTGTGCAAGGTCCCTATTTTCAATAATTGAATTTTTCTTGTAACGAAGTGGCGTTCTTTCTGCTTTTTTTCCCTAATAGTGCAACCAGAGAGGCCCATAGCAGTATCCATAAACACAATAAATACATTGTACATATCTATCATAAAATGTTTATTTATTCGGCAATAAAAGAACACAATAATTATTATTCTAGAATGTATGGGAATCATCATTATCCCAAAACCCTAAGCCATGCTTTCAATCTCGGTTGGATTTGTGAGCTAATGTAAGTGTTTCCAAATTCTAACAAGCAATCAATCTCAGATGCTACATTGTCATGGAGCTTTCCAGTTCTCCTTCGTTGTCAAGTTCC

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q3UEB3	Poly(U)-binding-splicing factor PUF60 OS=Mus musculus OX=10090 GN=Puf60 PE=1 SV=2
Q9WV25	Poly(U)-binding-splicing factor PUF60 OS=Rattus norvegicus OX=10116 GN=Puf60 PE=2 SV=2
Q9UHX1	Poly(U)-binding-splicing factor PUF60 OS=Homo sapiens OX=9606 GN=PUF60 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003453 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00076 all species →	RRM_1	RNA recognition motif	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR051974 all species →	Family	Poly(U)-binding-splicing regulator	Interproscan
IPR034212 all species →	Domain	PUF60, RNA recognition motif 3	Interproscan
IPR000504 all species →	Domain	RNA recognition motif domain	Interproscan
IPR012677 all species →	Homologous_superfamily	Nucleotide-binding alpha-beta plait domain superfamily	Interproscan
IPR035979 all species →	Homologous_superfamily	RNA-binding domain superfamily	Interproscan
IPR003954 all species →	Domain	RNA recognition motif domain, eukaryote	Interproscan
IPR034209 all species →	Domain	PUF60, RNA recognition motif 1	Interproscan
IPR034211 all species →	Domain	PUF60, RNA recognition motif 2	Interproscan
IPR006532 all species →	Family	Poly-U binding splicing factor, PUF60-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR47330 all species →	POLY(U)-BINDING-SPLICING FACTOR PUF60-B-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000380 all species →	Biological Process	alternative mRNA splicing, via spliceosome	Interproscan
GO:0000381 all species →	Biological Process	regulation of alternative mRNA splicing, via spliceosome	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0006376 all species →	Biological Process	mRNA splice site recognition	Interproscan
GO:0071011 all species →	Cellular Component	precatalytic spliceosome	Interproscan
GO:0071013 all species →	Cellular Component	catalytic step 2 spliceosome	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12838	PUF60; poly(U)-binding-splicing factor PUF60	-	Spliceosome	ko03041	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora pulchra tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora pulchra, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →