Gene detail

Detailed information of FUN_035777-T1 in Acropora pulchra

Genomic Location: ptg000025l:11585645...11596971
NR annotation: XP_029191114.2, terminal nucleotidyltransferase 4B-like [Acropora millepora]
Species Acropora pulchra · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

FUN_035777-T1

ATGCTTTCCCCATTGATGATGGCTTCCAGAATGGGCTGGATTCAACAAGAGCAAAACGGTCCAACATTTGAAACATGGAGCGACGTGTTGGGGGACGTTAATTCACCATCGACAAAACCGGGAAATGTTTATGATGAAATGGCGAATTATATCCCTTTGAACCGTAAAAATAATTTACATGAAAATGTAGAGAGCACCACTTTCAAGAACATGATTAACGAGGGAAAAAATCGTGTCAGTAAGAAGAAAAAAATTGAAGACGGAACTCCTTGGTGGTCAAAGGATAAAAAGTATCCAGACGGCCCGGTGGGGCTTCACGAGGAAATGTGGGACTTTTACAACTTTATGAAGCCTCTTCATGAGGAACATGCTATGCGACAAGAGGTGATATCGAGAATTCAAAAAGTCGTTAAGGGACTGTGGCCAACAGCTGAAGTGGAGGTGTTTGGGAGCTATAGAACGGGGCTTTATTTACCAACCAGTGACATAGACATTGTTATTTTCGGAAAGTGGGAGAGACTACCATTATGGACGCTCGAACAAGCTCTCACTGCAAATAAAATCGCCGAGGCTTCCACCATTAAAGTCTTGGATAAAGCTTCAGTTCCTATTATAAAGCTTACAGACCAAGTAACCAAGGTGAAATTGGACATAAGCTTTAACACCCCAGATGGACTGAAAGCAGCAGACTTTGTTAAGGATCAAATGGAGATTTTTCCTTGCCTTCCACCTTTAGTACTTGTTTTGAAGCAGTTCCTTGTGCAGCGGGATCTGAATGAGGTGTTTGCTGGTGGAATAAGCTCCCACTCTCTTGTTTTAATGATAATCAGTTTTCTGCAGCAACATCCTAGAAAAGATGGAAGGACTCTTAAAAGCAACCTTGGAGTTCTTTTAATTGAATTCTTTGAACTCTATGGCAAACATTTTAATTATGAAGATGTTGGCATTCGCGTTAAGGATGGTGGATCATACTTCAACAAACAAGAGGCTTTTCATGGTATGGATGGAAACAGCCCAGATAATTATTGTGCTCCTCTTTGCATTGAAGATCCCACCACAGAAGGCAACTACTTGGGAAAAAGCTCTTACAAATTCCTGGATGTGGTGCACTCCTTTGGTTATGCATATGGAATGTTGAGCAAGTCTGTTCTATATGATGTTACGACAGACAGAACAAACCCTGGAGTGACAAAGGAAGGGGATTCTGTGGGATATCTTGGACAGATAGTGAGGGTCAAAAGTGAAACACTAGAATATCGGGAATGGGTTGCCAGTGTGTGGTCTGTGGATAGTGCTCCACTCATTAAGCAATCAGCCCCTACATATGCCAGTATTGCAAATAGACATGTCCAGACCCATGCTATTACATCTCAAGATTCCTCTGACAAAAATGCCACATGGAACAGGTCACAATCAAACTTGGAAACTCCGATGAGAGAAGGCAAGGGTGAACCTTTTGTCAAACATGCCAGTGTGGACTGCCGTTCAGTCAGGGGAATGTCTTCAGTTCAAAATTCAGCAGATTCACTAGCTCAAGATATGATACCTGAAAAGATAGCTGCTTATGAAACAAGAACTTCTGTTTTTGGAGGCTCTTCAAAATCTCTGAACTTCCAACCTGCGAACAATAATGAATTGAGTTGTCCGTCTAAAGGGAGCTTGTATTCTGAAGCAATAAAGCAATCACCAACTAAAACCAAGCAAACATTCACCTCCATGCCCAAGACCTCTGCTGTTACTTCAACTTCAAAATCAAAATTGACTGCAAAATCTTCAAGATCCTCTGTTTCTGACGTAACACACATGGTTAAAACAGTGTCATCATCAGCAAGGTCTTCAAGCAAAGCCTGTTTTTCAGACCCCATCTCAAAGGCTAAAGTTTCTTGTGATTCAGGATTGACATTTAGCAAGACCAATTTTGTTGACTCAGTGACCAAGACAAAGGAAAGAGATCTCCAGAAAACAATGGATGAGCAAAAATCTTCAGCCACTTCAAATAGCATTAATACTGTAGTTTGTGTTCCACCAAAGTTGGATCTTAATCCTCCAAGTCAGCTCAGTAAAGGCAATGGCATTGGGAAACAAAGTTCAACAATCACTGTTTCGACACCGACAAAGGACAATACTAGTAATTGCCAAAATAACAACATCACTGTCTCAAAGGACGCGACAAAACGAAAACATGGAAAACCAACCAAGAGTAAAAAGGAGAAGAGCTCTTAA

Transcript

FUN_035777-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8NDF8	Terminal nucleotidyltransferase 4B OS=Homo sapiens OX=9606 GN=TENT4B PE=1 SV=2
Q68ED3	Terminal nucleotidyltransferase 4B OS=Mus musculus OX=10090 GN=Tent4b PE=1 SV=2
Q6PB75	Terminal nucleotidyltransferase 4A OS=Mus musculus OX=10090 GN=Tent4a PE=2 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006631 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03828 all species →	PAP_assoc	Cid1 family poly A polymerase	Family	Interproscan
PF01909 all species →	NTP_transf_2	Nucleotidyltransferase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR043519 all species →	Homologous_superfamily	Nucleotidyltransferase superfamily	Interproscan
IPR045862 all species →	Family	Nucleotidyltransferase Trf4-like	Interproscan
IPR002058 all species →	Domain	PAP/25A-associated	Interproscan
IPR002934 all species →	Domain	Polymerase, nucleotidyl transferase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23092 all species →	POLY(A) RNA POLYMERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003729 all species →	Molecular Function	mRNA binding	Interproscan
GO:0004652 all species →	Molecular Function	obsolete polynucleotide adenylyltransferase activity	Interproscan
GO:0005730 all species →	Cellular Component	nucleolus	Interproscan
GO:0031123 all species →	Biological Process	RNA 3'-end processing	Interproscan
GO:0031499 all species →	Cellular Component	TRAMP complex	Interproscan
GO:1990817 all species →	Molecular Function	poly(A) RNA polymerase activity	Interproscan
GO:0016779 all species →	Molecular Function	nucleotidyltransferase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K03514	PAPD5_7, TRF4; non-canonical poly(A) RNA polymerase PAPD5/7	EC:2.7.7.19	Transfer RNA biogenesis	ko03016	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora pulchra tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora pulchra, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →