Gene detail

Detailed information of FUN_039032-T1 in Acropora pulchra

Genomic Location: ptg000027l:13945584...13957625
NR annotation: XP_029205766.2, fatty acid synthase-like [Acropora millepora]
Species Acropora pulchra · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

FUN_039032-T1

ATGAGGAAATCTGTAGCCTGCGGTAAGATGGTTCAGCACATTACTGAGGATATTGTGTTGGCTGGCATGGCTTGCAGAGTTCCAGAGTCTGATAATGTTGAAGAATTTTGGTATCATCTCATCAACAAAGAAGACATGGTCACAGAAGATGATCGTCGCTGGACGCCGGGACTTCACGGGCTGCCTAAACGTGGTGGAAAACTTAAAGATATAAAACACTTCGATGCAACCTTCTTTGGAGTTCATGCTAAGCAAGCAAATAAGATGGATCCCCGATTAAGAATTTTACTTGAACTTACGTATGAGGCCCTGATTGACGCGGGTGTTGACCCTCAAACTATTCGGAATTCCAAGACTGGTGTCTTTGTTGGTGCCACTAGCTCAGAGGCTGCAGAAGCCTTCAGTGCGAATACTGAAAATGTTGTTGGTTATGGTATGACTGGCTGCTGCCCAGCAATGTTATCTAATCGAATCTCATTTTCATTTGACTTTAAAGGACCAAGCTTCACTATTGACACTGCTTGTTCGTCATCATTATTCGCTATGGACTGTGCAATCCAGGCAATCAGATCCGGGAGTTGTGATGCTGCCATTGTTGGTGGTGTTCGTCTGACATTAAAACCCAATACTGCCGTAGAATTCTTACGACTGAATATGCTCTCTTCTGATGGTGCATGCAAGTCATTTGATGCCAGTGGTGACGGTTACTGCCGTTCAGAAGCAGCCGTTGCTATTTACGTCACAAAGAGACTAGAAGCAAAGAGGGTTTATGCCCATGTTATCAATTCCAAGACAAACTCTGACGGATACAAGACACAAGGTGTCACATACCCCAACGGTGCGTTACAAAAACAGTTACTAGAAGAAGTATATGCTGAGGCTAAGATTAATCCTGCAGATGTCGAATATGTGGAGGCTCATGGCACAGGGACAAAGGCTGGTGACAAAGAGGAACTGAGTGCAATTACTAGTGTGTTTTGCAATGGTCGTGACCATAAGATGGGACCCTTGTTAATCGGCTCTGTAAAGTCCAATATGGGTCACCCTGAGCCCACATCAGGTCTATGTGGAGTAGCTAAGGTTTTACTTGCTATGCAACATAAAATAATCCCACCTAATTTGCACTTCAACACACCCAACCCCAACGTACCTGCTCTGCTGGATGGAAGACTTAAGGTTGTAGATGAACCATTATCATGGAAAGGTGGCATTGTTGGTATAAGCTCATTTGGATTCGGTGGTTCCAATGTTCATGTGATTCTGAAGTCTCCTAGCATACCAGAAACAAAAGAACCGAGAAAGCCCTCTCTTCCCGTAGTGATCCCTGCGTCAGGAAGAACAGAAGAGGGGGTCAAGAAACTGCTCAAGTTTGCAAAAACAAACGAAGAAAACACAGACCTGCTATCTCTGTTAACAGAAATTTCCTCCACACCTTTGGCCACGTTCCCCTACCGCGGTTATGCTGTGATTGGCAATGGAAACAGCGTAGAAGAAGTTGTTGCTGTGCAGCCAAAGCCAAGGCCGCTTTGGTATGTCTTTTCTGGTATGGGAACACAGTGGACAGGCATGGGAAAGAAAATGATGCAGATTCCTATTTTCCGGGATTCAATTTACAAGGCAGCTGAGATTCTAAAGGAGTTTGGACTAGACCTGGTTAAGGTTATTTTGGAAAGCAATGAAAAAACTTACAGAAACATCACAAACTCCTTTGTTGGCTTGGCCTCTATTCAGATTGCATTGGTGGATTGCTTGACAGCGTTGGGGCTCACCCCTGATGGAATAGTTGGCCACAGTGTTGGAGAACTTGGCTGTGCATACGCTGATGGTAGTCTTACTGCTAAAGAGGTCATTTTAGCTGCCTACTGGAGAGGTCGATGTGTTGAAGAAGCCAAACTGCCACCAGGAGGAATGGCCGCTGTGGGTCTGACGTGGGAAGAAACGAAGAACAGGTGCCCAGCAGGTGTGACTCCTGCTTGTCACAATGCTATAGACACCGTTACAATCTCTGGCGATGCAGCTGCTGTTAACAAGTTTGTGAAAATGTTGAAAGAAGAAGATATCTTTGCAAAGGAGGTCAACACTTCAGGGATTGCTTTCCATTCCACTTATATGGCTGTCATAGCACCAACATTGAAAGAGGCATTAGTTAAATGCATTATTCCTAAGAAGAGATCAAGTCGGTGGATCAGCACGTCCATTCCCGAAGAGAAATGGGACACTAAATTGGCAAAGTACTCGTCTGCAGATTATCATGTTCACAACTTGGTAAGCCCGGTTCTATTCCTGGAAGCTCTTGGAAAGGTACCTGATGATGCTGTCGTGGTAGAGATTGCCCCTCATTCTCTTCTGCAAGCCATTCTTAAGCGATCTCTTAGCCCACAGACCATCAGCATCCCTCTGATGAAGCGAAATCATCCAAACAATCTAGAATTTTTTTTGTCTGGGGTTGGCAAGTTGTACTCAAGTGGCTTCAACTTTGATCCTACACCTATCTCCATGGAAAGAGCATCCTTCCCTGTTGATGTTACAACCCCTTCCATTGCTCCACACATGGAATGGGATCATTCCCAAGAATGGGATGTACCCTCATGTGCTGATTTCCAGTTTAGCAGCAATGATGGAAGTGCTACATCTTGCAACTTTGAAATTGATCTGTCATCTTCAGATAATAAGTACCTTGAAGGGCATTGTATCGACGGACGTGTTCTGTATCCAGCTACTGGATATCTGGTTTTAGCGTGGAGAACCCTGGCAAAATCTATGGGTCTTCTTCTAGAACACACATCAGTTGCCTTTGAAGACGTCATCATCCATCGAGCTACCATCCTACCCAAGACAGGTGCTGTGACATTGAAAGTCCACTTAATGCCCGCTTCAAACACATTTGAGGTGTCAGAAGGAGACAGCTTGGTGGTCACAGGAAAGATATTCTTTCCAGAATTTTCAGCGCTTAGTGAAGACTCCAAGCGTGCTCCTTCAACTGCGGAAGATGTCTTCTTATCAAGAGATTGTATCTATAAAGAGCTGAGGTTGAGAGGATACGACTATGGCCCGACATTTCAAGGAATTGTTGCAGCAAACATGTCTGGTACGTCTAATCCCATTTGTCTTATCCAATATTAA

Transcript

FUN_039032-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P12276	Fatty acid synthase OS=Gallus gallus OX=9031 GN=FASN PE=1 SV=5
P19096	Fatty acid synthase OS=Mus musculus OX=10090 GN=Fasn PE=1 SV=2
P12785	Fatty acid synthase OS=Rattus norvegicus OX=10116 GN=Fasn PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003225 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF21089 all species →	PKS_DH_N	Polyketide synthase dehydratase domain	Domain	Interproscan
PF00698 all species →	Acyl_transf_1	Acyl transferase domain	Domain	Interproscan
PF16197 all species →	KAsynt_C_assoc	Ketoacyl-synthetase C-terminal extension	Family	Interproscan
PF00109 all species →	ketoacyl-synt	Beta-ketoacyl synthase, N-terminal domain	Domain	Interproscan
PF02801 all species →	Ketoacyl-synt_C	Beta-ketoacyl synthase, C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR049552 all species →	Domain	Polyketide synthase, dehydratase domain, N-terminal	Interproscan
IPR049900 all species →	Domain	Polyketide/metazoan fatty acid synthase, dehydratase domain	Interproscan
IPR014043 all species →	Domain	Acyl transferase	Interproscan
IPR032821 all species →	Domain	Polyketide synthase, C-terminal extension	Interproscan
IPR042104 all species →	Homologous_superfamily	Polyketide synthase, dehydratase domain superfamily	Interproscan
IPR014030 all species →	Domain	Beta-ketoacyl synthase, N-terminal	Interproscan
IPR016035 all species →	Homologous_superfamily	Acyl transferase/acyl hydrolase/lysophospholipase	Interproscan
IPR016036 all species →	Homologous_superfamily	Malonyl-CoA ACP transacylase, ACP-binding	Interproscan
IPR001227 all species →	Homologous_superfamily	Acyl transferase domain superfamily	Interproscan
IPR050091 all species →	Family	Polyketide and Nonribosomal Peptide Biosynthesis Enzymes	Interproscan
IPR018201 all species →	Active_site	Beta-ketoacyl synthase, active site	Interproscan
IPR014031 all species →	Domain	Beta-ketoacyl synthase, C-terminal	Interproscan
IPR016039 all species →	Homologous_superfamily	Thiolase-like	Interproscan
IPR020841 all species →	Domain	Polyketide synthase, beta-ketoacyl synthase domain	Interproscan
IPR020807 all species →	Domain	Polyketide synthase, dehydratase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43775 all species →	FATTY ACID SYNTHASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016740 all species →	Molecular Function	transferase activity	Interproscan
GO:0004312 all species →	Molecular Function	fatty acid synthase activity	Interproscan
GO:0006633 all species →	Biological Process	fatty acid biosynthetic process	Interproscan
GO:0004315 all species →	Molecular Function	3-oxoacyl-[acyl-carrier-protein] synthase activity	Interproscan
GO:0016746 all species →	Molecular Function	acyltransferase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for FUN_039032-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora pulchra tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora pulchra, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →