Gene detail

Detailed information of FUN_046718-T1 in Siderastrea siderea

Genomic Location: contig_65:1385254...1396043
NR annotation: no NCBI-NR hit recorded
Species Siderastrea siderea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

FUN_046718-T1

GCCCGGTTTGACCAGTCTCGTGTCCACCACCCCCACGTGGAAAACGCGTGACCCAGCATGCATCACAGTAGATTGCAAAATATAGATAATGACGTCATTAGGACAATTTCACTTCCGTGAAAGGTCAGTTCCGGTCATCACTCAGTTTGTTGCATGATGGGAAGGACTCTTGAGCAAGCAAAGTAAAATGGCTGCCACTATCAAAGATCCAGAAGAGGACAAGTCCAAGAGGAAACATCTCAAAGCTGTTTTAGTGAACAAGCTGGAGGGATGCAGCGATATAGTTAACATGGCTGTCACCATCCCGCATGAAGATGCAGTCATAAGCGTTTCGGATGACAAGAGTATTAGGCTTTGGATTAAAAGAGAAAGTGGACAGTACTGGCCTAGCATTTGTCATGTTATGGAATCTGCTTGTTCTGCCTTAGATTATCATGGAACAAGTAGAAGATTGTTTGTAGGATTGGCTAGTGGCGTTATTTCAGAATTTGATGTGTCTGAAGATTTTAACAGACTCCACCACAGAAGGAATTATTTAGCCCACATGAACAGAGTGAGTGGTGTGATCTTCTCCCTGGAGAATGAGTGGCTGCTGAGTGTGGGTAGAGACAAATACCTACAGTGGCATGATTGTACCAATGGCAAAAGATTGGGTGGATATCAGACTGAAGCCTGGTGTACTTCACTACAATTTGATGCTGATTCCAAACATGTGTTTGTTGGAGACTATGGAGGTCACATTAGCATTATTAAATTGGAGAATAACTCGCCAACTCTGGTGACGACACTCAATGGTCACTCAGGGAGTGTGCGAGCACTGGCATGGGACCCTGAGAAAAGGCTCTTATTTTCTGGTAGTTTTGATGAATCCATTATAATTTGGGACATTGGAGGACAACAGGGAACTGCTTTTGAACTCCATGGACATTTATCGAAAGTACAGGCTCTATGTTACGCACCACATGCCAAAAAGTTAATATCATGCAGTGAAGATGGACTTGTCAGAATTTGGGACATGAATGTAAAACGAAAGGAGACACCAGAGTGGTCACAAAGTGACATCTGTGAACGATGTAGCGGTCCTTTTTTCTGGAATTTTAAGGTTATGTGGAACCAGAAAACAGTTGGTGTTCGGCAGCATCATTGTCGCAAGTGTGGCAGAGCCGTATGTAACGAGTGTAGTAACGGCGAATCAACTTATCCCATCATGGGCTTTGAAAATCCAGTCCGCCTGTGTACTGAGTGTTATGAATCCATCACAGATGATGATCGAGTACCTTTGGCAGATTTTCACGATGCAAAACACACAACGCGTTCAATGTACCTGGACTTAACTAAAGGAAGATTACTGACTTGTGGCGGTGATCGGATCGTTAAGGTAAAAAACTACAAACAATTACAGGTCAGGGTCTAATTTGAGGGTCCCCAGTAGATTTTTCGGGATCCAGGATTTGGCTTATTTGAAAACCGGATTTCGGGATTTTAGAGGAAAGGGAGAGCGAGATTCGGGATTGTAATTATGAACGGGATACGGGATTTAGCGATTTACGATGAGAGATTTGGGAAATGTTGTCGTAAAGAACCAGTATCCGGTAACGAAAAGTGAAAAATCCTTTCATTTTGACAACACATTAGTTGCCCACATTTTCCTTGACCCTGTCACTTGCCTATTTTGACCGTACCACTTTTCTTATTCCACCATCTTCCACTGGTTCACTGCAGATGAGGGAATCTGAAATCTCTGTAAGGCACTTTTTAAAACGTATGTTCAGGATCGGGATAACACGATAAAAACCGTCGGGATTACGGGATTGAGGGAAAATTTTGGTCGGGATGACGTGTTGGAAATACCCTATTTTACAATCCATGCACGTTCACTTTGTTGTGGTGGATTTGCACTTTTGCCACCTACGTCTACCTAGAGATGAGAAAACTGGACGTTTTCACGGCGTGACCGGATTAAAGGGTTTTTATAACCTTAGAAAATGATTGTATGAGCTTTTGTTCGGTCAAAGAATAAATTGGCTGAAAAAGTGAGGTGGCTAACAAGGTGACGGTAAGGCTTCCTTTGTACAACTTTTTATTCGCTTCCTTTTTAGATTTGGGACGTTAAAGCAATCCTACTATCATGATGTGAAACCGTTATTAGAAACCTTCAGGATAGCAAACATTTGGACAACTGTATGACTG

Protein

Gene family

Family type	Membership / link
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01363 all species →	FYVE	FYVE zinc finger	Domain	Interproscan
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR019775 all species →	Conserved_site	WD40 repeat, conserved site	Interproscan
IPR000306 all species →	Domain	FYVE zinc finger	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR020472 all species →	Repeat	G-protein beta WD-40 repeat	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR017455 all species →	Domain	Zinc finger, FYVE-related	Interproscan
IPR042234 all species →	Family	WD repeat and FYVE domain-containing protein 1/2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46189 all species →	LD41958P	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005769 all species →	Cellular Component	early endosome	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K23532	WDFY2; WD repeat and FYVE domain-containing protein 2	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of FUN_046718-T1 across 85 RNA-seq samples of Siderastrea siderea. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

85Samples

6TPM > 0

7Conditions

28.9Max TPM

1.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
holobiont · low.pH_high.temp	20	0	0.00	0.00
holobiont · low.pH Control.temp	20	0	0.00	0.00
holobiont · control.pH_high.temp	20	0	0.00	0.00
holobiont · control.pH Control.temp	19	0	0.00	0.00
Whole organism	4	4	16.13	19.98
unannotated	1	1	23.41	23.41
live coral tissue/skeleton	1	1	28.90	28.90

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR22214402	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214403	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214404	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214405	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214406	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214407	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214408	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214409	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214410	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214412	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214413	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214414	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214415	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214416	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214417	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214418	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214419	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214420	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214421	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214423	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214424	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214425	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214426	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214427	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214428	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214429	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214430	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214431	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214432	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214434	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214435	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214436	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214437	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214438	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214439	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214440	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214441	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214442	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214443	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214445	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214446	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214447	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214448	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214449	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214450	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214451	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214452	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214453	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214454	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214456	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214457	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214458	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214459	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214460	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214461	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214462	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214463	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214464	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214465	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214467	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214400	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214411	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214422	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214433	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214444	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214455	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214466	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214468	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214469	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214470	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214471	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214481	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214492	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214506	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214524	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214535	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214546	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214547	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214548	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR14295603	Whole organism	Whole organism	not recorded	not recorded	SRP315757	19.98
SRR14295604	Whole organism	Whole organism	not recorded	not recorded	SRP315757	16.34
SRR14295601	Whole organism	Whole organism	not recorded	not recorded	SRP315757	14.25
SRR14295600	Whole organism	Whole organism	not recorded	not recorded	SRP315757	13.94
ERR12861049	unannotated	not recorded	not recorded	not recorded	ERP159209	23.41
SRR12454619	live coral tissue/skeleton	live coral tissue/skeleton	not recorded	not recorded	SRP277390	28.90

Source: CnidoSite RNA-seq expression matrices (SSIDE_TPM, StringTie quantification over 85 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.