Gene detail

Detailed information of HK74SY85_g31863 in Paraphelliactis xishaensis sp. nov.

Genomic Location: ctg1929:4698...6463
NR annotation: KPK28265.1, 3-phosphoglycerate dehydrogenase [Nitrospira bacterium SG8_3]
Species Paraphelliactis xishaensis sp. nov. · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

HK74SY85_g31863

GTCTCATTTATGCTGGAGCTCAAAAAAATATCGGGCCGGCAGGTGTGACGTTAGTGATTGTGCGGGATGATCTCATCGGCGATGTGTTGTCGACGACACCCAGTGTATTTGATTATGCCAAACAAGCCGACGCCGATTCGATGCTCAATACTCCTCCAACCTATGGGATCTACCTCGCTGGCTTGGTCTTTAAATGGATGAAAGCCCAAGGAGGACTAGCGGCCATGGGCACCATCAATGAACGCAAAGCGAAAAAACTCTATGCGGCTATTGATGAGTCAGATTTTTATAGCAATCCTGTTGAAATAAAATCACGGTCTTGGATGAATGTTCCATTTATTTTAGCCAATGCTGAGCTGGATAAAGAGTTTCTAGCTGGTGCCTTGGCTGCCGGCTTAACGACCTTAGAGGGCCATCGTTCAGTTGGGGGCATGCGTGCCAGTATTTATAATGCGATGCCTGAAGCGGGCGTCGATGCATTGATCGCATATATGGCTGATTTCGCAAAACGAAAAGCCTAATCAACGAATGAATCTTTGAGCCTCTTGATTCTTTTCGCAACGGAGTGATGTATGAATATTTTAGTGAGTGACAGTCTTTCTCCTAAAGGTGTGGAAGTGTTAGAGCGGGCAGGCTTTTCCGTTGCGGTTAAGACCAAATTGTCCAAAGAAGAGTTGTTGAAGGAAATTGGCAACTATGACGCGCTCATCGTACGTTCGGCGACAAAAGTCACAAAAGAGGTGATTGAAGCAGGTGGTCGCCTCCGTATTGTGGGACGTGCAGGCACTGGTCTAGACAATGTTGACACCGAAGCCGCGACACGTCGAGGGATTGTGGTCATGAACACGCCGGGCGGCAATACCATCACGACGGCTGAACACACGATGTCGATGATTGCAGCGATGAGTCGAAAAATTCCCCAAGCCACGAAATCAATGAAAGATGGCAAGTGGGAAAAAAGTAAGTTCATGGGAAGCGAATTATATAAAAAGACGTTAGGGCTAGTCGGGTTAGGTCAAATCGGTTCCTATGTCACAAAGTTAGCTCAGGGGTGGTCGATGAATGTCATCGGCTATGATCCCTATTTGGCTGTCGATCGAGCCAAACAAATGGGCATTGAGGTCGTGGAGCTTGACGAATTGTTCCATCGTGCGGATGTGATTTCCGTTCATACTCCGTTGACGAACGAGACACGCGGCATCATTAACACCGAGACGATGGCCAAGATGAAAGATGGCATCATGATCGTGAATTGCGCCAGAGGTGGCATTATCAACGAACAGGATTTATGCGAAGCCCTGAAATCTGGAAAAGTGGCAGCCGCAGCGTTTGATGTCTTTGAAAAAGAGCCAGTTGATCCCAATCACCCACTGCTGAGTTTGGATAATTTTACCTGCACGCCTCATATTGGTGCTTCAACAGAAGAAGCCCAAGAGAATGTCGCCATCGGTATTGCCGAACAGTTTGTGGATTATTTTAAACGTGGTATCGCTCGTGGTGCGGTGAACGTGCCTTCGGTGGCACCGGAGGTTTTGCCAAAACTTCAACCCTATTTGTCATTGGCAGAACGGATGGGTCGCTTTCAAGCGCAAATGTTAGATGGTGGGCTTAAATCCGTTACGGTTGAATATGTGGGCGAGGTTTCACAATTAGGAGTGGCTCCTATTACGGTCGCAATATTAAAGGGATTACTGTCTCCCATTCTTGAAGATGTCATTAACTTTGTGAATGCTCCCATTGTGGCGAAAGAGCGTGGCATTGAAGTGGTCTCATTTATGCTGGAGCTCAAAAAAATATCGGTGAGTGACAGTCTTTCTCCTAAAGGTGTGGAAGTGTTAGAGCGGGCAGGCTTTTCCGTTGCGGTTAAGACCAAATTGTCCAAAGAAGAGTTGTTGAAGGAAATTGGCAACTATGACGCGCTCATCGTACGTTCGGCGACAAAAGTCACAAAAGAGGTGATTGAAGCAGGTGGTCGCCTCCGTATTGTGGGACGTGCAGGCACTGGTCTAGACAATGTTGACACCGAAGCCGCGACACGTCGAGGGATTGTGGTCATGAACACGCCGGGCGGCAATACCATCACGACGGCTGAACACACGATGTCGATGATTGCAGCGATGAGTCGAAAAATTCCCCAAGCCACGAAATCAATGAAAGATGGCAAGTGGGAAAAAAGTAAGTTCATGGGAAGCGAATTATATAAAAAGACGTTAGGGCTAGTCGGGTTAGGTCAAATCGGTTCCTATGTCACAAAGTTAGCTCAGGGGTGGTCGATGAATGTCATCGGCTATGATCCCTATTTGGCTGTCGATCGAGCCAAACAAATGGGCATTGAGGTCGTGGAGCTTGACGAATTGTTCCATCGTGCGGATGTGATTTCCGTTCATACTCCGTTGACGAACGAGACACGCGGCATCATTAACACCGAGACGATGGCCAAGATGAAAGATGGCATCATGATCGTGAATTGCGCCAGAGGTGGCATTATCAACGAACAGGATTTATGCGAAGCCCTGAAATCTGGAAAAGTGGCAGCCGCAGCGTTTGATGTCTTTGAAAAAGAGCCAGTTGATCCCAATCACCCACTGCTGAGTTTGGATAATTTTACCTGCACGCCTCATATTGGTGCTTCAACAGAAGAAGCCCAAGAGAATGTCGCCATCGGTATTGCCGAACAGTTTGTGGATTATTTTAAACGTGGTATCGCTCGTGGTGCGGTGAACGTGCCTTCGGTGGCACCGGAGGTTTTGCCAAAACTTCAACCCTATTTGTCATTGGCAGAACGGATGGGTCGCTTTCAAGCGCAAATGTTAGATGGTGGGCTTAAATCCGTTACGGTTGAATATGTGGGCGAGGTTTCACAATTAGGAGTGGCTCCTATTACGGTCGCAATATTAAAGGGATTACTGTCTCCCATTCTTGAAGATGTCATTAACTTTGTGAATGCTCCCATTGTGGCGAAAGAGCGTGGCATTGAAGTG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O29445	D-3-phosphoglycerate dehydrogenase OS=Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16) OX=224325 GN=serA PE=3 SV=1
P73821	D-3-phosphoglycerate dehydrogenase OS=Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa) OX=1111708 GN=serA PE=3 SV=1
Q58424	D-3-phosphoglycerate dehydrogenase OS=Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) OX=243232 GN=serA PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003461 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF19304 all species →	PGDH_inter	D-3-phosphoglycerate dehydrogenase intervening domain	Domain	Interproscan
PF00389 all species →	2-Hacid_dh	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain	Domain	Interproscan
PF02826 all species →	2-Hacid_dh_C	D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR045626 all species →	Domain	D-3-phosphoglycerate dehydrogenase, ASB domain	Interproscan
IPR029009 all species →	Homologous_superfamily	Allosteric substrate binding domain superfamily	Interproscan
IPR006236 all species →	Family	D-3-phosphoglycerate dehydrogenase	Interproscan
IPR029753 all species →	Conserved_site	D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding domain conserved site	Interproscan
IPR006139 all species →	Domain	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain	Interproscan
IPR036291 all species →	Homologous_superfamily	NAD(P)-binding domain superfamily	Interproscan
IPR006140 all species →	Domain	D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR42938 all species →	FORMATE DEHYDROGENASE 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004617 all species →	Molecular Function	phosphoglycerate dehydrogenase activity	Interproscan
GO:0006564 all species →	Biological Process	L-serine biosynthetic process	Interproscan
GO:0016616 all species →	Molecular Function	oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor	Interproscan
GO:0051287 all species →	Molecular Function	NAD binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K00058	serA, PHGDH; D-3-phosphoglycerate dehydrogenase / 2-oxoglutarate reductase	EC:1.1.1.95 EC:1.1.1.399	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Paraphelliactis xishaensis sp. nov. tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Paraphelliactis xishaensis sp. nov., and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →