Gene detail

Detailed information of KAF0991012.1 in Henneguya salminicola

Genomic Location: SGJC01000985.1:5886...11703
NR annotation: KAF0991012.1, hypothetical protein HZS_2706 [Henneguya salminicola]
Species Henneguya salminicola · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KAF0991012.1

ATGTTTTATGATAAAATTAGAACTGCAAATATTACAAAAGCTTGTTTAGGTTTTGATTGTGAAACTTTTTATATTGGAACAAAACGATCTGATGTACATTTTTATGAGATTTCAAAACGAATATTTAAAAATTTTATTCTCTCTGAAGAAATTGTTCTTCAAAATTATGGAATTAAAAAATATTGCTCAAAATTAGGTTGCGTTGAATCATTAATGCCAAATAATTCAGAAAATCAAAAAATAATTATTGGATATTCATATGGTATTATTTTAATTTGGGATGTTAAATCAATGCGAATATCATCATTTATGAATAAAAACGAACAATTATTCTCAGTTTGTTGGGGAACAAATGAATCAATGTTTGTATCTTCTCATTCTCATGGCTTAATTTGTTGTTGGTCATGCGCAAAAACAACAAAAGATAATGATATTTTAGGAAATTATTCTCCAGTACCTTTTTATCCAAGAGATAAAATATCTTGTCAACATATTAAAAAAATAATTTGGCGAGATTCTTTTTTTATTTTTTATGGAGGATTGCCAGATAATATCTCTTGTGAACGTCATATTTTATCAATGATGACTGGTGGAACAATAAGTCAAATTATTGAAGTAGGTTCAGCTATAATAGATTTTATCGACTTACCCATCGATTTACAATTACATTCAGAATTAAAAAAAAATTCGTTTTTTTTAATGATTTTAACAGAACATGAATTAATTACTTTATTAATTGTTCCTAATAGAATCGATCCTAATACATTGACTGTTGCCCCATATACAATTAATCAAGTTCTTCCATATCATCTTCCTCCAATAACAACATCTTGTGTAACTACCAGTTGTATAGTTTCATGCGTTTCTCCATCATTTTTGGAAGATATCGTAGAAAGTGGTAAAAGAGATTTTTTATCCAATTTCGTTGATATATGGCCATTGGATGGTGGATATTCATATAAAACAAACCAAAATAAACAAGATAAAAATCTTATAATTACTGGTCATGAAGATGGTTGTATTAATTTTTGGTATATTACTATAAAAAAAGAATCCCCTATGTTATATCGCATAAAAACATCAGATCTATATATACAAGATGAATATTTAAATAATGAGCTGGATGATAAAAATCAAAATATTTGTTCATTAATACCTCAAAAATATGGATTCTATAATCCATATTGTGATGATCCTAGACATACAATACAAAAAATATATTTATGCGAACAAAGTTTTACATTAATTGTAGGAGGAAGTGCAGGAAATGTCTTAATATTCAAATTAAATCAAAAAAAAAATTTCATTCAACCCACACCAAATCGTATTGAATGTAATTTAATTCAAAAATATCCAAGTTTTATTTGGAAAGGACATGATAAATTAAATCTTAAAAATAATTTATCTCTTTCTTCAGGATATTATCTCGATACTGTATTATCAATTCATCCATCTTCTCCAATTTCATCCATATCATATTGTTTAAAATGGGGATTATTAGCTGTTGGAACATGTTATGGATTTTTATTATATGACTGTTTTTCTAAAACAATTATTTACTGCGCATGTACATATGATATTTCTGGTATTAATTTATATATATATGAAAAAAAAGGAATAACTAGTGGAGGTGAAAATATACAAAGAAATTCATTTTTAAGATCTTTAAGAAACTCGTTGAGAATATTTTCAAAAAAGAAAAAAATAAATAATCCCCAAGAAAATCATCAGAAAAGTTTAGGAAAATGTGTTAAAGAACAAGAAATTGATTTTATATCAAAGGAATCATTATTTAATAGAAGTGGTTTAGGTTCTGGACAATTCACACGAATTGTTTCTCAAAATACAGAATTATTAAAAACTAATCGAGAATCGTTAAGATTTCAAGCAATAATGGAAATGTCTAATAGATTTATTAGTGGAAAAAAAATAGATCCTACTTTGAAAGGTTTAATTAGAAGTTTATGTTTTGTTGAATGTCCTATATCATCAAATAGTTCAAATATAAAACCAATGTTAGTTGTAGGATCAAATTGTGGAAAAATATATATTATAGTACTTAAATTTCAAATATTTAATGATGATAAAAATATTATATTAAAAACAGTTGATTGTAGTAAAGAAATTCAAATGAATCATAAAGCTCCAATAATTGGATTTCAAATGATTGGAAAAAATGGAGAATATATTGATGTATCATGTTTTAAAACTGTTCAAAATAATATAACATTATCATTCAATCATTATTTATTATGTTGTACAGAAGAACAAATAAAAATAATTAATTTACAAAATTTTAAAACTAAATTAAAAACAAAAATAACTGTAAATGAAGGAAATAGATTAAAAAAATCTATTATAATTAATACAAAATATAATTGTTTTGATGAATTTTGTAGATATTTAATAGCAATTTCAACAACTGGAAAATTACTTATTTATTCACTTCATAATCTTAAAATGTTAAATTGTTATAATTTAATACCTAAAGAAGATATATTATCTATTACAACATTATGTTTGAATAATAAAGGATTTGGTGTATATCAATGTACTTCATATCAATTAAATACATTAACGATTATATCAAATAAATATAATCAACAACATTCATCTTTAATTCCAATTCCAATTCCAATCTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5RCX2	LLGL scribble cell polarity complex component 2 OS=Pongo abelii OX=9601 GN=LLGL2 PE=2 SV=1
Q6P1M3	LLGL scribble cell polarity complex component 2 OS=Homo sapiens OX=9606 GN=LLGL2 PE=1 SV=2
Q3TJ91	LLGL scribble cell polarity complex component 2 OS=Mus musculus OX=10090 GN=Llgl2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003530 (this species only) · gene tree & orthology
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08366 all species →	LLGL	LLGL2	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000664 all species →	Family	Lethal(2) giant larvae protein	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR013577 all species →	Domain	Lethal giant larvae homologue 2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10241 all species →	LETHAL 2 GIANT LARVAE PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005096 all species →	Molecular Function	GTPase activator activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0008593 all species →	Biological Process	regulation of Notch signaling pathway	Interproscan
GO:0019905 all species →	Molecular Function	syntaxin binding	Interproscan
GO:0030864 all species →	Cellular Component	cortical actin cytoskeleton	Interproscan
GO:0030866 all species →	Biological Process	cortical actin cytoskeleton organization	Interproscan
GO:0032878 all species →	Biological Process	regulation of establishment or maintenance of cell polarity	Interproscan
GO:0045159 all species →	Molecular Function	myosin II binding	Interproscan
GO:0050708 all species →	Biological Process	regulation of protein secretion	Interproscan
GO:0051294 all species →	Biological Process	establishment of spindle orientation	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for KAF0991012.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Henneguya salminicola tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Henneguya salminicola, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →