Gene detail

Detailed information of KAJ7356182.1 in Desmophyllum pertusum

Genomic Location: MU827323.1:62549...73396
NR annotation: KAJ7356182.1, Ribonucleoside-diphosphate reductase large subunit [Desmophyllum pertusum]
Species Desmophyllum pertusum · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KAJ7356182.1

ATGTCTGACAACGTTAAGCAAGAAAATCCATCGGAAACGATGCACACTTACGTCGTCAAACGCAATAAAAAACCTCAGGCGATTTATCTGGACAAGATCACTGCTAGGATCTCAAAGCAGGCCTATGGGCTATCTGAGTTTGTAGATTCGTTTGGAATTATCAAGAAGGTAATAGCAGGAATTTACCCGGGAGTTCAAACGACCGAGTTGGACACCCTTGCAGCCGAGATTGCTGCCTCCATGACCACCATACACCCAGACTATGCCATTCTTGCAGCCAGAATTGAAGTTTCTAATCTTCACAAGGAAACAAAGAAGATATTCAGTGAGGTGATGACAGATCTGTACAACTACACCAACGCTAAGAATAATAAACATGCTCCGCTGATTTCAAAGGAGGTTCATGATCTCATAATGAAAAATGCTGATCGTCTCAATTCTGCTATCATTTATGATCGTGACTTTTCCTACAACTACTTTGGGTTTAAGACTTTGATGAGGTCTTACCTGCTTAAGATCAACGGCAAAGTTGCTGAACGACCACAGCACATGCTGATGCGTGTTTCAGTTGGAATCCACCAGAATGATATCGATGCTGCCATCGAAACCTACAATCTGTTGTCGGAGAAGTGGTTCACGCATGCATCGCCGACGCTGTTTAATGCTGGAACTTGTAAACCACAGATGTCCAGCTGCTTCTTGCTGACGATGTCAGATGACAGTATTGATGGCATTTACGACACGCTGACTACTTGTGCGAGAATTTCTAAGTCAGCTGGCGGAATTGGCATCAATATGCACAATATCAGAGCTTCTGGGAGCTACATAGCAGGGACCAATGGAGTGTCAAACGGTCTTGTACCAATGTTGCGCGTTTATAATGCAACGGCAAGATATGTTGACCAAGGGGGAAACAAGAGACCAGGAGCCTTTGCTATATACTTGGAACCCTGGCACGCTGACGTCATTGATTTCTTGGACTTGAGAAAGAACACAGGCAAAGAGGAACAGCGTGCTCGTGACCTCTTCTATGCTCTGTGGATCCCTGACCTGTTTATGAGACGTGTCGAGGGTGATGGGATGTGGTCTCTTATGTGCCCGAATGAGTGCCCTGGACTACAGGACTGTTGGGGAGAGGAATTTGACAAACTTTATGAAAGCTATGAGAAACAAGGAAAGTTCCGCCGACAAATGAAAGCCCAGACGCTGTGGTTTTCAATTTTGCAAGCGCAGGTAGAGACAGGCACGCCATACATGCTGTACAAAGATGCATGCAACAGCAAAAGCAACCAACAGAATGTTGGGACCATCAAATGCAGCAATCTGTGCACTGAAATTGTGGAGTACAGCAGTCCAGATGAAGTTGCTGTCTGTAACTTGGCTTCTCTCGCACTCAACAAATTTGTAACTGATGAAAGTCCAGCACAATTTAATTTCCAAAAACTCTTTGAAGTCACACAGGTCGTGACACGCAACTTAAACAAGATTATTGATATCAACTATTATCCAGTGAAGGAGGCTGAACGATCTAACAAGAGGCACAGACCTATTGGCATTGGGGTGCAGGGAATGGCCGATGCCTTCATTCTGATGAGATATCCATTTGAAAGCAATGAAGCCATAGAATTGAACAAGAAAATATTTGAGACAATCTATTATGGAGCTCTGACGGCATCCTGCAAGTTGGCCAAAGAAAAGGGAGTGTATGAAACATACGAAGGATCTCCTGTCAGCAAAGGGAAACTTCAATACGACCTCTGGAACGTTACTCCTTCAGATCTGTGGGACTGGGCAGCACTTAAGGCTGAAATAAAAAGGTATGGGATAAGGAACAGTTTGTTGTTAGCACCAATGCCGACAGCTTCGACTGCACAGATCCTTGGTAATAACGAGTCTTTTGAGCCTTACACAAGCAACATCTACTCAAGACGGGTACTCTCAGGAGAATTTCAGATTGTTAATCATCATCTATTAAAGGACTTGACTGAGAGGGGACTGTGGAATGAAGCATTAAAAAACAAACTGGTGTATAACAATGGATCTATTCAGAATATTGACGAGATCCCTGACGATCTGAAGCCACTGTACAAGACAGTTTGGGAAATCTCCCAGAAGACTCTTGTAGACATGGCTGCCGACAGAGGAGCATTCATTGACCAAAGCCAGTCGTTCAATGTGTTCTTTGCTGACCCTACCTATGGCAAGTTGACAAGCATGCACTTCTACGGCTGGAAGAAGGGCCTCAAGACTGGAATGTATTACCTGCGTACACGCCCAGCTGCTAATGCAATTCAGTTCACTGTGGATCAGGAATCCCTCAAGAAGACGACGAAGACCAAAAAAGAGAATGAAGAAGCCATAGCTTGCTCCCTTAACAATCCCGAGGCCTGTACAAGCTGCAGTGGTTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P07742	Ribonucleoside-diphosphate reductase large subunit OS=Mus musculus OX=10090 GN=Rrm1 PE=1 SV=2
P23921	Ribonucleoside-diphosphate reductase large subunit OS=Homo sapiens OX=9606 GN=RRM1 PE=1 SV=1
Q5R919	Ribonucleoside-diphosphate reductase large subunit OS=Pongo abelii OX=9601 GN=RRM1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003674 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02867 all species →	Ribonuc_red_lgC	Ribonucleotide reductase, barrel domain	Family	Interproscan
PF03477 all species →	ATP-cone	ATP cone domain	Domain	Interproscan
PF00317 all species →	Ribonuc_red_lgN	Ribonucleotide reductase, all-alpha domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR005144 all species →	Domain	ATP-cone domain	Interproscan
IPR000788 all species →	Domain	Ribonucleotide reductase large subunit, C-terminal	Interproscan
IPR008926 all species →	Homologous_superfamily	Ribonucleotide reductase R1 subunit, N-terminal	Interproscan
IPR013346 all species →	Domain	Ribonucleotide reductase, class I, alpha subunit, C-terminal	Interproscan
IPR013509 all species →	Domain	Ribonucleotide reductase large subunit, N-terminal	Interproscan
IPR039718 all species →	Family	Ribonucleoside-diphosphate reductase large subunit	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11573 all species →	RIBONUCLEOSIDE-DIPHOSPHATE REDUCTASE LARGE CHAIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004748 all species →	Molecular Function	ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0009263 all species →	Biological Process	deoxyribonucleotide biosynthetic process	Interproscan
GO:0005971 all species →	Cellular Component	ribonucleoside-diphosphate reductase complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10807	RRM1; ribonucleoside-diphosphate reductase subunit M1	EC:1.17.4.1	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Desmophyllum pertusum tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Desmophyllum pertusum, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →