Gene detail

Detailed information of KAJ7369607.1 in Desmophyllum pertusum

Genomic Location: MU826899.1:59823...82619
NR annotation: KAJ7369607.1, Dynein heavy chain 14 [Desmophyllum pertusum]
Species Desmophyllum pertusum · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KAJ7369607.1

ATGTCTGGGGGTGAGTGGTATTCTGGGACGTGTGGCGCTTATCTGATCAAGATGGCGGAAGCGAATTTACTTCTCGGTAAAGAAGTAGCAAGTGAGATTCGACAGAAGTTGAAGGAAGATGTTGCAGCAATCCGAGAAGAAAATGAAGCATTCAAACCAGGACTTGCCATTGTGCAGATTGGTGACAGGAGTGACTCTACTGTGTATATCAAGTCAAAAGTCAAGGCAGCTGAAGAGATTGGTATGTTTGCCAGGCATGTGAAGTTGCCGAGGACCTCCACTCAAGCAGATGTTCTCAAAGCTGTGGATGAGCTGAACAAGGATTCAACAATTCACGGCATCATTGTGCAGCTCCCCCCTGACTCTGAAGAGCCGATTGACCCTGCGATTTGCACGAATGCTGTGGCTCCAGAAAAGGATGTTGATGGGCTGCATGATGTGAATGCAGGAAAGTTGTCAAGAGGAGAATTAAATGACTGTATTGTGCCTTGCACTCCTAGAGGTTGCCTGGAGTTGATAAAAAAATCAGGTACAGAGATTGTTGGAAAAGAAGCAGTAGTCCTGGGAAGAAGCAAGATAGTGGGTTCTCCCATGGCAGATCTTCTCAAATGGCATCACGCTACAGTGACAACATGTCACTCAAAGACCAAAGACTTGCCAGATGTGGTGAGAAGGGGAGATATTGTCGTTGTTGGAATTGGAAGAGCTGACTTTGTAAAGGGGGACTGGATTAAGGAGGGAGCTGTGGTTGTTGACTGTGGAATTAAATGTGATTCCAGGTGTTGGGCCAATGACTGTGGCGATGTTGATGAACAACACAGTGGACCGTGCCAAGAGGGCTCTTCAAATGCAAAAGAATATCTCACCCGGAGACAGCCCGTGGATGCAAACTTTCGAATGTGGCTGAGTTCCAAACCAGACCCTTCCTTCCCAGTCTCCATCTTGCAGGCTGGACTCAAGATGACTGTGGAACCTCCTCCTGGCATCAAAGCCAACCTGCTGCGCTCCTTAGGGGGAGTGGGTGGAGTAGTGACCGAGTCTGTCTGGGAAGACTCGGGGCCTGGACCGGCTTGGAAGAGGCTTCTGTTTGGTTTGTGTTTCTTCAATGCAATCGTGCATGAAAGAAAGAAGTTTGGCGCCCTGGGATGGAATATCCCGTATGAGTTCACTGCCTCGGATCTGGAGGAAGTGCCTTGGAAAGCCATCAGATATCTGACAGGTGATATCGTGTATGGTGGCCGAGTGACAGATTACTGGGACCAACGCTGCCTGCAGAGCATCCTGGGAAAGTTTTACTCTCCAATGGCCTTACAAGAGAGTTATGGCTACACGGTGGACTATGTATACCGTCCACCACCCCCTGAAATCTCGTTGTCAGTATGCTGTGAGTACATTGAAGGTCTGCCTACTGTTGATGCTCCTGAACTGTTTGGTATGGATCAGAATGCAGGCACGGCCTTCCTCGCTAACCAGGGCAGAGCTCTCATAGCAGACCTGCTGGCCGCCCAGCCACGGCTCACGGCGGCTGTAGGTTCGAACAAAACCAATGATGACATTGTCCTGGATCTAGTGAGTGACACTTTAAAGTACCTCCCCCAAAGGGTGGACTCTACCTCCGATGGATTAACCGCTGGTCTGCTGGACCCAAGGCTCGGATCTGTCAGTCCAGATCGCCTGAGGCAGATGACTCAAAAGAAGCTGTCCCAGGATCCTTTGGCAGATCATGCTGATCAATCAGTATACGTCACGGTCTTGAGGCAGGAAATAAACCGGTTTGACCGGTTGCTGGGTATTATTCATACGTCACTCTCATCATTGCGATTAGCAGTTAAAGGAGAAGTGCTCATGTCTGAACAGTTGGAGGAAGCATACAATGCTTTGCTTTGCAACCGCGTTCCTAAGGCTTGGGAGCAAGCGGCGTATGAATCATGCAAACCGCTGGGAGCCTGGGTCGACAATCTGGCCAAAAGAGTGGACTTCTTCAGCGGTTGGTTAGACTTGGTCAGGAAAGACAAAACATCCAAGTCCCGGATGTCACGTGAATCTGGCGTCACATCAACACCAACGCCCAGCCAATCATCGATGTCCGTGTCTGCACCACGTGTTCACCCTAATGCTTTCTGGTTACCTGCTTTCTTTTTTCCTCAAGGTTTTCTCACAGCCATTTTACAAACACATGCTCGTGAACGTAACGTTCCAGTTGATTCGTTAAGTTTCTGTTACCGAGTATTGAACGAAAAGTGGACAAACCAAGAACTGGTTCACAGTGAAAGCAACGTTGATTTTAAACGAGTCGCCTTTCAGGTGAGAAAATGTCTCAAGTGTGATTGGGCAACTTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9C0G6	Dynein axonemal heavy chain 6 OS=Homo sapiens OX=9606 GN=DNAH6 PE=1 SV=3
P27653	C-1-tetrahydrofolate synthase, cytoplasmic OS=Rattus norvegicus OX=10116 GN=Mthfd1 PE=1 SV=3
Q922D8	C-1-tetrahydrofolate synthase, cytoplasmic OS=Mus musculus OX=10090 GN=Mthfd1 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001676 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00763 all species →	THF_DHG_CYH	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain	Domain	Interproscan
PF18198 all species →	AAA_lid_11	Dynein heavy chain AAA lid domain	Domain	Interproscan
PF02882 all species →	THF_DHG_CYH_C	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain	Domain	Interproscan
PF18199 all species →	Dynein_C	Dynein heavy chain C-terminal domain	Domain	Interproscan
PF03028 all species →	Dynein_heavy	Dynein heavy chain region D6 P-loop domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR020630 all species →	Domain	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain	Interproscan
IPR041658 all species →	Domain	Dynein heavy chain AAA lid domain	Interproscan
IPR020631 all species →	Domain	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain	Interproscan
IPR042219 all species →	Homologous_superfamily	Dynein heavy chain AAA lid domain superfamily	Interproscan
IPR000672 all species →	Family	Tetrahydrofolate dehydrogenase/cyclohydrolase	Interproscan
IPR041228 all species →	Domain	Dynein heavy chain, C-terminal domain	Interproscan
IPR036291 all species →	Homologous_superfamily	NAD(P)-binding domain superfamily	Interproscan
IPR046346 all species →	Homologous_superfamily	Aminoacid dehydrogenase-like, N-terminal domain superfamily	Interproscan
IPR004273 all species →	Domain	Dynein heavy chain region D6 P-loop domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR043160 all species →	Homologous_superfamily	Dynein heavy chain, C-terminal domain, barrel region	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22878 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004488 all species →	Molecular Function	methylenetetrahydrofolate dehydrogenase (NADP+) activity	Interproscan
GO:0007018 all species →	Biological Process	microtubule-based movement	Interproscan
GO:0008569 all species →	Molecular Function	minus-end-directed microtubule motor activity	Interproscan
GO:0030286 all species →	Cellular Component	dynein complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for KAJ7369607.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Desmophyllum pertusum tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Desmophyllum pertusum, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →