Gene detail

Detailed information of KAJ7382034.1 in Desmophyllum pertusum

Genomic Location: MU825946.1:122229...139606
NR annotation: KAJ7382034.1, hypothetical protein OS493_037623 [Desmophyllum pertusum]
Species Desmophyllum pertusum · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KAJ7382034.1

ATGGATCGCCATTCACCTACTGCAAATGGCGACTGTTATTGCGACGATGAATCGAGTTACCAAGATACAAGCGTCTGTGATTATGATGGGAATATATTGCCAGACTTGCTGGATTCACAAATAGACAGTACACTACAAGGTTTGAACATGGGCGCTATTAAGAAGAATTCTTACGAAAGAACCCGAGCTGCCATGGCGGCAATAAATCCTATGTTGGCAAAGAAAGTCCTACCTTTGCCCAATGAATTATCAAAAGAGGAAGCAGCAGCGATTTGTATCCAGGCTCACTTCAGAGGATACCTGGCAAGAAAGCTGTTTGTGCAGCTTCTGTATGAGCGCTACATTAAGGAGGAAGAAGAACGTGAAGCGAGAACAAGACAGCAAGTGGAGGAGGGAGAACTTTTGGTAGAAAACTATCATTTAAACCTTGAAATGGAAGAGAATACATGTTTACGTAAAAACCTTAGAAGAGGAATTGAATGTGATGTTATAACCATTCAAAGAGCCTGGAGACAACACAGGAGAGAATCTCAAGATCAGTTATGTGTTGGACATGGAGCAGAGAATTCATATAATACGTCAAATTTTGACTTGGTGTCACAACCACATTACTCCACCCTGGACAGTAGCAGTTTCCATATAAGGACAAACCCATTTATGGGGAGTAATGAGAATGCTTCTTACTGTGATGATGACAATCTTTCCGATGTTTTTAATGACAGCCTTGAGCAAGTAACCGAAGAAAATTTGAGAAATACACAAGAGCATGGACCACACAGACATATTTATGATAGTGATCATGTTATTGACGATTTTAACGATGAACTTCCCGGAATGGATTCTGTCAGCTCACCGGCAGAGTTGCCATCACCGACTACGGACTGGGAGTCGATAGAATCCTGCCTCACTTCAGAGGGTGAAACACAAGATTTAGAAAACAGCGAACTTCTTGACTCATCCAATGAAAGGCTAAAACATTTTTCTTTGAAACCTAAGGATTTGCAGATTTGTTTTGTTGACGATACATTGCTCAGTGACGTTGAAGGCGATGAGGATGGCTGTGTTATAAAAGAGTATGTAATTGATAAACAAGATATTTCTGATGAAGAGAAAAGAGATTCAGGTTGCGTGGCGGGCGATGAGGAAACATCTGAGTCTTTTAGTATTAAAACAGTTAAACCAGAAACCCTGGAAAATCAGGAAATATCCAAGGAGGAATCGGAGAAGGTTTTGTTAGAACTGAGTCAACAAGAGAGCGAGGGGGAAGAAAAAGAGGAGAGTTGTTCAATTGTAATGCAGGGTTGGACTGATGAAAGGTTACAAGGACTGACTCTGGATGAACTCAGAGCTCTCAGGAAAAACATGGGACAGTTGATTGAAGCTCAAAATGAAGTGCTGGTCACAGAGTTAATGAACAGAGATAGTCTTCATCTTAAACAAGACTCTCTTCTGATGGATGTCGAGGATGCATCAAATGGACAGCTGCCCGAAAGTTATGTTGGCAAAGAAAATGCCATGACGGTCATAGGAGCCCCCGAGTGGAGAGAAGCGTTGCGTGACAAGAAGAGAAGAGCAGTGTCGAAACGCCGGGTAGATGAAAAGTTTCACAAGTATATACAGAAAATAACAACGAGTTCAGCTTTTAATGGCTTTATCATGGGAGTAATAGTCCTGAATTCCTTAGTCATTGGTTTTGAGACAGTAGAAGAGTGGAAAACAGCCTACGCTAATGAATTCAAAGCATCAGATGAATTCTTTCTGGCCATCTACACTATGGAATTCCTCATGAAGCTATACGCAGAGCCAAGGGGTTACTGGAAAAGCAGTTACAACAGATTTGACTTCACTATATTGGCCTTGTCATATGTTCAAGTCATTATGGATGAGCTTAATGTTGGCGATAAGATTCTCACACCTTTAAGACTTCTACGAGCTGCCCGTACCTTGCGGACCATCTCGTTTATCGAAGGCCTCCAGGTTCTTGTCATAGCGTTGATTGACACCATCAGGAATTCTGTGTTTAATGTCGTGATTCTTCTTACAATGCTGATGGCTTTCTTTGCTGTTGTCGGTTATTATATTTTTGGATATGAAGAAGAGACGGGTGATAAAGAGAACTGGGGGACTCTGAGTACAGCGATGCTGACACTTTTCACATTTGTGACTGTGGATGGTTGGACTGAAATTCAGAAAGATCTTGACAAAAGACCCTACAGTCAGTGGTTCACAGTCATCTTCATCTTCTTGGGTCACTTCATTTTCACTAATCTGTTTATTGGTATCATAATTATGTTGAAGAAAGATTTTCTCTTCCAAAGGCAACATGATGATGTCAAAGAAATGTTGGAAAAGCAGGCATTTGTTACTACTTCAGATCACATGGATCTTTACATGTCCAGATGCCAGCAGACTCAATTTCAAATTGCCAATGTGTTGGCAGACATGGTAGAGATGAAATTGCAGGAAAAAGAACAACAAGAAGCAGCTCAAGCGACTCCTCTGCCGAGAGGATTGCAGTTATTCATGAGAGCCAAGGCTGGATTAGCAAAAAAGACTTCTTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q80W99	Cation channel sperm-associated protein 3 OS=Mus musculus OX=10090 GN=Catsper3 PE=1 SV=2
Q86XQ3	Cation channel sperm-associated protein 3 OS=Homo sapiens OX=9606 GN=CATSPER3 PE=1 SV=1
C9D7C2	Voltage-dependent calcium channel type A subunit alpha-1 OS=Apis mellifera OX=7460 GN=CAC PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003444 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00520 all species →	Ion_trans	Ion transport protein	Family	Interproscan
PF10148 all species →	SCHIP-1	Schwannomin-interacting protein 1	Family	Interproscan
PF00612 all species →	IQ	IQ calmodulin-binding motif	Motif	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000048 all species →	Binding_site	IQ motif, EF-hand binding site	Interproscan
IPR027359 all species →	Homologous_superfamily	Voltage-dependent channel domain superfamily	Interproscan
IPR005821 all species →	Domain	Ion transport domain	Interproscan
IPR015649 all species →	Domain	Schwannomin interacting protein 1, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR47131 all species →	CATION CHANNEL SPERM-ASSOCIATED PROTEIN 3	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005216 all species →	Molecular Function	monoatomic ion channel activity	Interproscan
GO:0006811 all species →	Biological Process	monoatomic ion transport	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0001669 all species →	Cellular Component	acrosomal vesicle	Interproscan
GO:0005245 all species →	Molecular Function	voltage-gated calcium channel activity	Interproscan
GO:0006814 all species →	Biological Process	sodium ion transport	Interproscan
GO:0030317 all species →	Biological Process	flagellated sperm motility	Interproscan
GO:0036128 all species →	Cellular Component	CatSper complex	Interproscan
GO:0048240 all species →	Biological Process	sperm capacitation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for KAJ7382034.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Desmophyllum pertusum tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Desmophyllum pertusum, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →