Gene detail

Detailed information of KAJ7386471.1 in Desmophyllum pertusum

Genomic Location: MU825876.1:1928940...1976928
NR annotation: KAJ7386471.1, Retinol dehydrogenase 13 [Desmophyllum pertusum]
Species Desmophyllum pertusum · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KAJ7386471.1

ATGGCGGTACCAGTTGCAGTTGGTGCAGTAGCAATCGCAGTCCTTTATGCCGGTAAAACTTACTTCCAAGGTTCTCGATGCCACAGCACCAAAAGCCTAAAAGGCAAAACTGTTGTTATCACGGGCGCAAATACCGGCATCGGTAAAGAAACCGCAGTGGATTTAGCCACGCGTGGAGCGAGAGTTGTCATCGGTTGCCGAAACCTGGAGAAAGGCAAGGCAGCACTAAAGGAAATACAAGGGCGAAGTGGAAGCACAAACGTCTTCCTCGAGGAGCTAGACCTGGCCTCGTTAGATTCAGTACGCAAGTTCGCAGACAACATCCTGAACAGCGAGCCCCGGCTAGACATCCTGGTCAACAATGCTGGTGTGCTGGCTTGCCCTTATCAGAAGACTGAAGATGGTTTTGAAATGCAGTTTGGAGTTAACCATCTGGGCCATTTTCTCCTAACTATACTACTCCTTGATCTGCTGAAGCGTTCGGCGCCTAGTCGTATTATAAACGTGTCTTCTCTAGCTCATAAGTTTGCATTTGGAGGCATAAACTTTGATGACATCCATTTTGAAAGGAATTACTTCAACTATGGCGCTTATAATCACAGCAAGCTTGCAAATTTGCTCTTTACAAGAGAGTTGAGCAAACGTCTTGAGGGTACCCATGTGACCACCAATGCACTTCACCCAGGGGCGGTCAGTACAGATTTGCAGCGCCATTCTTTTATATCCAATGCACTGGTGTCCCCACTCCGCTGGTATTTCTTAAAGACCGCTGAACAGGGAGCCCAGACCACTATTTACTGTGCAGTCTCTGAAGAGATGGAAGGTGTAAGCGGCAAATATCTGGCAGAGTGTGGCATTGTGGAGCCCACCAAAGCTGCGCAAGATGATGACGCAGCAAGGAAGTTGTGGGATCTTAGCTTGAAGTTGATAATTGCCATGAATTCCGTCTCTGACATCTGGCTTCTAGTAGCTTCAGCCGCTGGAATCGTCCTCGTTTGTAATCTGGTTTATATTAGTCTGGTGAAGAAATACCGCGTCGCAAGACAGCTACTAGCTTCGTTTCCCTCAGCTCCAAGTCACTGGCTTACAGGACACCTCAAGTACGTAAAAAAGCATGATGGCGCTGCTCTTCAGTTCCATGTTCGATGCGCTACTGAATTCAAAACATGTTATATGGTACGGAGGGGTCCTACCATGACAAACCTAGTACTGTGTCATCCAGAGACGATCAAGGTTATTCAGAGTGGCAATGCTCCTAAATCATTTACATACCAACTTCTCAAGCCTTTCTTTGGAGATGGGCTGATTGCTTCAAATGGAGACAAGTGGTTCAGAATGAGAAGACTTCTCACTCCAGCTTTCCATTTTGAGATCCTCAGATCATACGTCAGAATTTTCCAGGATTCTACAAACATTGTCTTAGAGAAGTGGTCCTCACCAGAGAGTGGTCAGGTGGAATTGTTCCATGATGTGAGTTTGATGACGTTGGACTCCATTTTGAAGTGTGCTCTCAGTTACAAAACCAACTGTCAGACTCAAGAAAAAAGGAATCCTTACATTAAAGCAGTTTATGAGGCATCTGAAGAGATCTTAAACCGGCTCATGAACCCATTGTTATTTTCAGATATAATTTACCAACTGACACCAGGAGCAAAAAAATTCACTAAGGACTGTGCTCTTACCCAAGCTAAAGCAAAAGAAGTCATCAAGGAAAGGAGAGCTGCTTTACAAGATAGTGATGAGCAAGAGAAGCTTAGGAAAAAGAAATACTTGGACTTCCTAGATATCCTACTTGCAGCCAGGGATGAAAGTGGAAACGGTTTGTCAGAGGAAGAAATCACATCAGAAGTCATGACATTTATGTTTGCAGGACACGACACCACTGCGAGCTCTATCTCGTGGACATTGTACAATTTGGCAAGGTTTCCAGAACACCAAGAGAAATGCCGAGAAGAAATTAATGAAGTGTTTGGCGACAAAGAAGAGTTTGAATGGAACGATCTTGGTAAACTGAAATATGTTCTGCTATGCATCAAGGAAAGCAACAGACTGTTTCCTCCAGTCCCCAGGTTAGTCGATTGTTGGACAAGCCATGCGAGATTGACGGGACACTTGTGCCTGAAGGGACTTGGGTCACATCTCATATATTGCCTTGCATCGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8NBN7	Retinol dehydrogenase 13 OS=Homo sapiens OX=9606 GN=RDH13 PE=1 SV=2
Q17QW3	Retinol dehydrogenase 14 OS=Bos taurus OX=9913 GN=RDH14 PE=2 SV=1
P33274	Cytochrome P450 4F1 OS=Rattus norvegicus OX=10116 GN=Cyp4f1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000348 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00067 all species →	p450	Cytochrome P450	Domain	Interproscan
PF00106 all species →	adh_short	short chain dehydrogenase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002347 all species →	Family	Short-chain dehydrogenase/reductase SDR	Interproscan
IPR036396 all species →	Homologous_superfamily	Cytochrome P450 superfamily	Interproscan
IPR001128 all species →	Family	Cytochrome P450	Interproscan
IPR036291 all species →	Homologous_superfamily	NAD(P)-binding domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43157 all species →	PHOSPHATIDYLINOSITOL-GLYCAN BIOSYNTHESIS CLASS F PROTEIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004497 all species →	Molecular Function	monooxygenase activity	Interproscan
GO:0005506 all species →	Molecular Function	iron ion binding	Interproscan
GO:0016705 all species →	Molecular Function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen	Interproscan
GO:0020037 all species →	Molecular Function	heme binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for KAJ7386471.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Desmophyllum pertusum tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Desmophyllum pertusum, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →