Gene detail

Detailed information of KAJ7390017.1 in Desmophyllum pertusum

Genomic Location: MU825421.1:47701...53896
NR annotation: KAJ7390017.1, Speckle targeted PIP5K1A-regulated poly(A) polymerase [Desmophyllum pertusum]
Species Desmophyllum pertusum · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KAJ7390017.1

ATGGCGGACCAAAGTGCGATTGGAAAACAAGTATTTTGTGATGTATGCGGAGTCACTTTACCTTCAGCTTCTCTATTGCCAACCCACAACAAAGGCAAAAAACACCAAAAGTTGTTGAACTTAAAACAGGAGAGAGAAAACTCCTCTAGGAAAAGCATTTATGTTCGGGGATTTCAAAACTCTGGATCCATTGAAGAAGAGTTGGCTAAATACTTCAATGTATATGGAAATGTCTCAAACATTTTCTTGGACAAAGACAAGGGTGTTTTTGCTATAGTGGAGTTCACAAATGAAGAAAGTGTTTCCACAGTACTGACTCAGGAGTCGTTGCCACATTTAAATGGCAAACAACTAACAGTGAAAGAAAGAACTGTCAATAAAGCAGCTCACCAGTTTAAGGCACAAAAATCAAGGAAGCGCAAACACGACGACTCACAACAGTACCCAGAAGGGCATGGAGAAAACAAAGAATTGGCTCCATTTTTGTCTGAGGATCTCATTGTCAAACTGAAGTCATCTCAGATTACAGTGGAAGAACAAGTAAACTTGTTGATGGAGCAGTTGTGTCTAACTGATGAGGACATCAAGTTAAGGAGACTGGTTTGTGAGCTGTTGCATGAAGTGTTTGGCGAAGTCTATCCATATGCCGCAGTGGTGCCGTTTGGTTCTACTGTCAGTGGAGTAGGCTGGAAAGGAAGCGACTTGGATGTCTGTCTACTGACGAGTGAGCATGTTACGTCGTCTCAGTGTGACGACACTGGTGTTGATTACTCGTTAATTATTAACATGCTGCGTAGTTTTGCTCCTGGCTGTGTGAACATCATACCGGTATTGACAGCTAAATGCCCTCTTATCAAGTTTACGCATCAGCCTTCTGGCCTGTCATGTGACCTATCAGTGAATAACAGGCTTGGTGTTGCAAACTCCAGTCTCCTTCACTGCTACATGTCTCTTGATCCCAGGATCCCTCAGCTGGTGTTTGTTGTGAGAGCCTGGGCAAAAGCCAAGGCTCTTACCGTTGGTAGACAGTTGTCAAACTACGCATTGACCCTGATGGTGTTGTACTTCCTACAGACACAAAATCCACCTGTTGTTCCCTCGTTACAGCAGGGATTCGATGCATGGATAAATAAACAATCAGATTCGTGTAGTACTAAAGATCACGGTAGTAGTGAGCCACTTGTTGTAGACATCAAGTCCGAGATGATTGACAACTGGAACTGTTCATTCTTCGCAGATGTCGCCAGACTTTCTCCGTCACAGAATACCAAAAGTCTAAGTCAGTTACTGGAGGAATTCTTCTTCTTCTTTTCAACTGAATTTGACTTTGCCAATTGTGTGGTCAGCATAAGAAGTGGTCACGGTACAAGCATTGCATCAGTGTTAGAAGAGTTAAAGGGTGCGGAATGTTCGGAAATGGATCATGAGGATACAAATAGGATTGCAAACAAGGAGGGTCCAACTTGTGTAAAACAATCAGAAACAGAAGAAACCGCTGAGAAACCGAAACCTATATCAAGTTCCAGACTGAGTGTTGCAAGTTCTTGTAGCAGTTCAGGGAGCGGCAAGAGAACAGAGTTCAAGATCTCCCCCTTGTGCGTTCAGGATCCATTTGAGCTTGTGCACAACTTAACACAGAACATTACCGTGTCAGCATTGAAACATATCATTGAATTAATGAAGATCGCTCACAAGATTTGCAAGGATCTAAACAGTGGTGGTGATAACCCAAATGCGACCAAACTGCTTGATCTGTTGACAGTTTGCAGATCTGCCAAGAAAAGAAAGAGTTCACACTGCCACTCTTTCTTTGTTGAGTATCAAGACATTAGTCCTCAAACATTTGATGCATCTTGCAGCGCCAAGCTAACTACACCCAGGGGAATTTTTCTGTTTATTGTCAAGACTTTAGAAAGGGAATTTGGATTGAAGTGTGAAATGAAATCTTTAGCAAAACGACCATGCAATAGTGGACAGGATCTGGGTATGTCGCAGGCTGCCCCGGCAGTTACTGCGCCACAAGTTGCCCAGGCAGTTACTGTGTCACAGGTTACCCAGGCAGTTACTGTGTCACAGGTGTCCCAGTCTCTTGGAGAGACCCCCACAGGAAGTTGCACTGATACTAGAAATGACTCTGATGCCAAAGAAGAGAACGATGAAGCAAGGACGTCGTTGGAAATTGATAAAAACGAAGACAACTTTTCAGCCATTTGTACAGCCTTTGAGAATACATGGACACATTGCCGTAAAGAACGACGCAAGTCCCTGCAACTTCAGAAGCAAAGAAATGAAAGTAGTGAAAATGATGGTAAAGATGCGTCATTTGAATCTGAGAAATCGGAGCAAACTTATCCAGAGAAATCTGAGGAACCAACTTCTATTACCTTGCCGCAACCCAAGGAGTTTGCAGATGTCCACACTGTTGCCTCTCCGATTCTTATTTTTGAACTGTATGTCAACAGTGCACCTCAAAAGGACACAAAGCATGGTTGTACTGTCTCGATGGAACAAGTTGAAAGTAAAGACTTCCAGCTATTTGGGAACTTCTTCACAGCTTATAAGAAATACTTCATGGGTTTAACAACAAAGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q4KMD7	Speckle targeted PIP5K1A-regulated poly(A) polymerase OS=Danio rerio OX=7955 GN=tut1 PE=2 SV=1
Q9D0D3	Poly(A) RNA polymerase, mitochondrial OS=Mus musculus OX=10090 GN=Mtpap PE=1 SV=1
Q9NVV4	Poly(A) RNA polymerase, mitochondrial OS=Homo sapiens OX=9606 GN=MTPAP PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004655 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17797 all species →	RL	RL domain	Domain	Interproscan
PF03828 all species →	PAP_assoc	Cid1 family poly A polymerase	Family	Interproscan
PF12874 all species →	zf-met	Zinc-finger of C2H2 type	Domain	Interproscan
PF01909 all species →	NTP_transf_2	Nucleotidyltransferase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036236 all species →	Homologous_superfamily	Zinc finger C2H2 superfamily	Interproscan
IPR000504 all species →	Domain	RNA recognition motif domain	Interproscan
IPR012677 all species →	Homologous_superfamily	Nucleotide-binding alpha-beta plait domain superfamily	Interproscan
IPR041252 all species →	Domain	RL domain	Interproscan
IPR002058 all species →	Domain	PAP/25A-associated	Interproscan
IPR043519 all species →	Homologous_superfamily	Nucleotidyltransferase superfamily	Interproscan
IPR013087 all species →	Domain	Zinc finger C2H2-type	Interproscan
IPR002934 all species →	Domain	Polymerase, nucleotidyl transferase domain	Interproscan
IPR035979 all species →	Homologous_superfamily	RNA-binding domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12271 all species →	POLY A POLYMERASE CID PAP -RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0006378 all species →	Biological Process	obsolete mRNA polyadenylation	Interproscan
GO:0016779 all species →	Molecular Function	nucleotidyltransferase activity	Interproscan
GO:0031123 all species →	Biological Process	RNA 3'-end processing	Interproscan
GO:1990817 all species →	Molecular Function	poly(A) RNA polymerase activity	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K18709	TUT1; speckle targeted PIP5K1A-regulated poly(A) polymerase	EC:2.7.7.19 EC:2.7.7.52	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Desmophyllum pertusum tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Desmophyllum pertusum, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →