Gene detail

Detailed information of KAJ7393480.1 in Desmophyllum pertusum

Genomic Location: MU825398.1:3626412...3637022
NR annotation: KAJ7393480.1, hypothetical protein OS493_006461 [Desmophyllum pertusum]
Species Desmophyllum pertusum · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KAJ7393480.1

ATGTTTCTTCCGAAACCGGACCGAGGAAGGACCGAGGTGAACTCGGAGATCATCGGAAAAGCCGAATGTACCCCGCTGACCGAAGAGTATGCGCAGAAAGACCTGTTTCAAATTCGCGCAAACCGCGGGAAGTGGAAAATGGCGGCGAACCTCAGCAAAGTTGCTGGAATGGGTTCGTGTATCAACGGTCATGTGGTACAGAACGATAGCGCTATGGCGGAAGCACAACAGGGACATGAAAAAGTGGCTATTCTAGATGCCGGGGCGCAATATGGAAAGAGTACGGGAACTATGTGTGGAGACAGAAATCCTCCCCTAGATACATCTATATACACTATACGAGAGAGAGGCTTTAGGGCTATTATAATATCTGGAGGACCAAACAGTGTCTATGCTGAAGATGCTCTTAAGTATGATCCAGCTATTTTCACCATTGGCATTCCAGTTTTAGGAATATGTTATGGAATGCAGATGCTCAACAAAGAGTTTGGAGGAAGTGTGATGAAGAAAGACATCAGAGAGGATGGGCAGTTCAAGATTACCGTGGAAACATCTTCGGCACTTTTTAGAGGATTGCAGTCGGAGCAAGAAGTTCTGTTAACACATGGAGATTCTATTGATCGGGTCGCTAGTGGCTTAAAGTCATTGCCAGGCATTGAGGACGAATCACGTAAGTTATATGGAGTACAGTTTCACCCAGAAGTAGATCTTACGGAGAATGGTGTCACAATGTTGAGAAATTTTGTTTACGGGATTGCGGGATGTTGTGGTACGTTCACTGTGGACAGCAGATTAGACACGTGTGTTCAACAACTTAAAAAGAATGTCGGAAACATGAATGTTTTAGTGCTAGTGAGTGGAGGAGTTGATTCCACCGTCTGTGCTGCGCTGCTTCACAAGGCTCTTCCTCAGGAACAAGTTATAGCTTTGCATGTTGACAACGGGTTTATGAGGAAGAATGAAAGTCAAGAAGTGGAAATATCCCTTCAACGATTAGGACTTAGATTAAAAGTTGTAAATGCTGCTTATCGGTTTTATAACAGTACAACTATAATATCTGGCAGACACGACCAATCAGCTGTCAAGAAACAAGTCACTAAAACGTTAAATGTAACAGCTGACCCTGAAGAAAAGAGAAAAATTATAGGAGATACATTTATCAAGATTGCAAATGACGCTTGCAAGGAGTTTAATCTTGATGAGACCAATACTTACCTGGCACAAGGTACCCTTCGACCCGATCTTATTGAAAGTGCTTCGTCACTTGTAAGTAACAAGGCAGAGGCCATCAAGACACACCACAATGACACAGATTTTGTGCGAAGTTTAAGAGCACAGGGAAGAGTTATTGAACCGTTGGCAGAGTTCCACAAAGATGAAGTCAGAGCTCTTGGAAAAGAGCTTGGTTTACCAGCAGACATTGTACAAAGACATCCATTCCCTGGCCCCGGTCTGGCTATTCGTATCATTTGCGGTGATGAACCTTATCAAGGAAGTGATTTTGCCGAAACGAATATCATACTTGGACAGATTGTAGACTTTGTTACTGCTATAAAAAAGCCGCATTCGCTGTTCAGTCGAGTCAAACTCAGTACATCAGAAGATGACAGAGAAGGCCTGTTACAGATCACATCAAAATACAAAATCGGCGCGTCCCTCTTACCTATCAAGTCAGTGGGTGTCCAGGGAGATGGACGGTCATACAGCTATGTTGTCGCTCTGTCGAGTAACGATACACCCGACTGGAAATCGCTTCTATTCCTCGCTAAACTGATTCCCAAAGTGTGTCATAATATCAACAGAGTTTGTTTCACGTTCGGAAAGAGGATCAAGTTCCAGATACAAGATGTCACTCCCACGTTTTTGTCACCAGGAGTGATAAGCACTTTGAGACAAGCTGATCATGTCGCATACTCTGTTATTCACAAACGTGATGTTGTGGACAAGCTCAGTCAGATGCCAATTGTTTTGATACCAATCCACTTCGACCGAGATCCCATCGACCACATTCCATCCTGTCAGCGGTCTGTTGTGATCAGAACGTTTATCACGAATGACTTCATGACGGGAGTCCCCGCTACTCCAGGAAAACAGATACCTATTGAGGTTTTGAACGAAATGGTTGCATCTTTGAAAGAAGTACAAGGCATCTCGCGAGTTTTGTACGATTTGACTTCCAAGCCTCCAGGAACGACAGAGTGGGAATAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P49915	GMP synthase [glutamine-hydrolyzing] OS=Homo sapiens OX=9606 GN=GMPS PE=1 SV=1
Q5RA96	GMP synthase [glutamine-hydrolyzing] OS=Pongo abelii OX=9601 GN=GMPS PE=2 SV=1
Q4V7C6	GMP synthase [glutamine-hydrolyzing] OS=Rattus norvegicus OX=10116 GN=Gmps PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003200 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02540 all species →	NAD_synthase	NAD synthase	Domain	Interproscan
PF00958 all species →	GMP_synt_C	GMP synthase C terminal domain	Domain	Interproscan
PF00117 all species →	GATase	Glutamine amidotransferase class-I	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR022310 all species →	Domain	NAD/GMP synthase	Interproscan
IPR025777 all species →	Domain	GMP synthetase ATP pyrophosphatase domain	Interproscan
IPR014729 all species →	Homologous_superfamily	Rossmann-like alpha/beta/alpha sandwich fold	Interproscan
IPR001674 all species →	Domain	GMP synthase, C-terminal	Interproscan
IPR017926 all species →	Domain	Glutamine amidotransferase	Interproscan
IPR004739 all species →	Domain	GMP synthase, glutamine amidotransferase	Interproscan
IPR029062 all species →	Homologous_superfamily	Class I glutamine amidotransferase-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11922 all species →	GMP SYNTHASE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003921 all species →	Molecular Function	GMP synthase activity	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006177 all species →	Biological Process	GMP biosynthetic process	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0003922 all species →	Molecular Function	GMP synthase (glutamine-hydrolyzing) activity	Interproscan
GO:0006164 all species →	Biological Process	purine nucleotide biosynthetic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01951	guaA, GMPS; GMP synthase (glutamine-hydrolysing)	EC:6.3.5.2	Peptidases and inhibitors	ko01002	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Desmophyllum pertusum tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Desmophyllum pertusum, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →