Gene detail

Detailed information of NY_Scal100_v1.31337.1 in Scolanthus callimorphus

Genomic Location: chrUn140:8199...32557
NR annotation: no NCBI-NR hit recorded
Species Scolanthus callimorphus · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

NY_Scal100_v1.31337.1

ATGACGAACCGCTACATGGGCGACTCTATTGAGGATTTCCAAGTGCTAGAACTCTTGGGTAAAGGTGGCTTTGCTTGTGTCTACAGAGGCACTTGCCTAGCTACGGGGCAGGAAGTTGCTATCAAAATGATTGACAAAAAAGCTATGAGAGCTTCTGGGATGGTGAAAAGAGTTTGTAATGAGGTGGAAATCCACTGTAGGCTAAAGCACCCTTCCATCTTAGAGCTCTACACTTATTTTGAAGATGACAACTATGTGTACTTAGTGCTTGAAATGTGCTCTAATGGGGAGGTCAACAGATATCTGAGAAAACTTGGGAAAACCATGGCTGAGAGTGAAGTTCGTCACATTATGCTTCAAGTTGTTAAGGCTGTCCTATACTTGCACTCTCATGGAATTATTCACAGAGATCTCACTCTTGGCAATGTTCTCCTTACTAGTGACATGGATGCTAAAATAGCTGACTTTGGCCTGGCCACCAGGCTATCCATGCCAGATGAGAAACACTACACCATGTGTGGAACACCTAACTACATCTCACCGGAAATAGCCACACGGGATCCCCATGGCTTGGAATCAGATGTTTGGTCTATTGGTTGTATGCTCTACACTCTGCTTGTGGGAAAACCACCATTTGATACCGAGGCTGTGAGGAGCACTCTCAACAAGGTTGTGTTGGCAGAATACAACACACCTGAGTACATTTCACTCGAAGCCAAGGACCTCATTTCTAACTTGTTGAAAAAGAACCCAAGTGACAGATTAACACTTTCAGGCATACTGGACCATCCATTCATGACGAATGAGACCCTGAAGACCAAGATGGTGTCACCTGTGAACTACAATCTGAACTCAAGGGGTTTCGAGCAATCTCTCGACAGTGGAACGGGAACAATGGCAACAGTATCCACGGGCCATGGTGTACGGGCGTCCCGGTCAGGAACCGGACACAAGACTGGCCATACCACCAGTGGCTTGTCCTCATCGGCTGAGAGAAACTCGGACATCTGGCCACGTGATCAACGTCATCCGCCCTCACCTCCGGTCAGACAGAGAGCCAGCTCATGTCCAAGCACAGAGAACTCTATCACCACTGACTCGTATCAGCTCCGCGGAAACGAGGCTGCTCAGCCCGCGGGGTTTCCTGGGTACAAACACAGCACTCGTAAAACAGATTCTTGGCTCTCAGACATCACAACGTCTGCATTTCCCAAAAAGATATCCCAGCAGCCCTTAGTGGGAATCGACAAACTGAATGGGCTCAAATCTTACAATGCCACCAAATACAGCAGTTACTATGGCAACACACTTGGTGACATGCTGAATGCCGTAGATCGCAATACTACAGACGCAAGCACCAGTGGTTTCACCAACGGGAACCCTGTGGATAAAAGACCCGTTCCGATCGACCATAACAACAACAAGGGTGACAATTGCCATATCCAGGCCTACTCGTCCGTAGTTGGACACAGGGATCCCGATAAGGAAACTCAAATTGGACACGAAGGGTTTAGAGGAGAACGCGGAAACACAAGAACAAGCCCGGAAAAGAGCAAAGACCTTAAATCGTACCGGAACCACAAAAGGCACGGTAGTGACAGCGTCAGCAAGGATCTGGACACTACACAGGAATCCCATCACAGGGGAGAAGACGAAGCCCGTCGAGAACCAAGAGGCGACCGGCAAGCGAGACGAAATCACAAGTCGCGCTCAGAGGGGAAGGGAAAGTCGTTAGGAGATCTAACGGAACCGTTGAACGCGGAAAGGCTTCGGCCGATTCGTCAGAAGACGCGGAATGCAGTAGTGAGCATTACGGATGAAGGAGACGTGTGCTTAGAGTTTATCAAACAAGAAGGAGGGCAAGACATCGTAACCGAAGTCATACGGATATCATCAAATGGCATGAAAATATGCGTGTACCACCCAGGCGGACGGGCGGGCCAAGTGCTCAGAACAGACCCTCCCGCCTCTCCCAACACTTGCGAGGGGTGGTACCTATTCTCCAACCTACCGAACAAGTACTGGAAGAAGTATAAGTATGCGGCCAAGTTTGTCACGCTGGTGCGGAAACTAACACCTAAGGTGACTTTGTACTCTAAGCACGCCAAGTGTGTTCTGATGGAGAACTATCCGCACGCCGATTTCGAGGTCTGCTTCTACAACGGCGCCAAAGTTCATCAGTCACAAGAGTGTACGCGGATTATCGAGCCTGGCGGGGTGTCCTATACAATGGAATCAGTGGGCGGGCTAGAGGGAGTACGTCTAGAGATGCGCACGCTTATCCAACACGTGCAGACCGCTTACCAGCGATGCTTGCAGCTTGAGAGAGCAATAGCTCACGAGGAGCAAGAGAGCGAGGGCGCGCGGTTTTTCCCCTTGATTGTGGGTCGCAGACCGTCCTCGTCTGCGCGCAGTAAAGGGTCAAGCGGTCAAGGAGGTGACCACAAGATACAGGAGCAGCGAAGCCGGCCCAATGAACCATGTCCATTACCTACGTCTCCTAGTATAGTCGCCCCTCCAGCCACCACTTCTCTTGTCTCGTTTGACGGCACCATCGCCAGCACCATACACCACACCACAGGGAAACCATCCAGCGCAAAAGGACCAACAATTGCGTCTTCCTCTAAACCGGCAAGAAGAGCTCCGTCTCCACAAAGATCACCAAGAAAAGTTGAAAAAGAAGACCGACGTGAAATCCCAGCACCGCCGAGTCCTACTCGACAGTTAAACCCTCTTATACCGACCACTCGGCAGTTGACCTCCCCTATACCGACCACGAAAGTTTGCAAGAACGCGTTTGTGGACGGGGTTGGATGGGCATCGCAGTTGACTACAGGTGAAGTCTGGATTCAGTACACCGACGGATCTCAGATAATATTCCACGCCGCAGCTGCTGCTGTCAAATACACTGATAGTAAAGGCGCCGTTAGCAGGTACGGCTACGCTGACCGTCTTCCACTTGTAATCAAGGAGAAGCTCTCTCATTTACCGGAAGTTATAGAAAACTACGAGCAGCATAATAATTCATTCCTACTAGAAATATATGTATACTATTATTACCTAAAGTCCTTTTTTGCGCCCCACATTTTCAAAACGTCGCTTTGA

Transcript

NY_Scal100_v1.31337.1

Protein

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005469 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF18190 all species →	Plk4_PB1	Polo-like Kinase 4 Polo Box 1	Domain	Interproscan
PF18409 all species →	Plk4_PB2	Polo-like Kinase 4 Polo Box 2	Domain	Interproscan
PF00069 all species →	Pkinase	Protein kinase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR046437 all species →	Homologous_superfamily	Serine/threonine-protein kinase, first cryptic polo-box domain superfamily	Interproscan
IPR008266 all species →	Active_site	Tyrosine-protein kinase, active site	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR033699 all species →	Domain	Plk4, first cryptic polo-box domain	Interproscan
IPR033698 all species →	Domain	Plk4, second cryptic polo-box domain	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR000959 all species →	Domain	POLO box domain	Interproscan
IPR047108 all species →	Homologous_superfamily	Plk4-like, second cryptic polo-box domain superfamily	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan
IPR033696 all species →	Domain	Plk4, C-terminal polo-box domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24345 all species →	SERINE/THREONINE-PROTEIN KINASE PLK	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0000776 all species →	Cellular Component	kinetochore	Interproscan
GO:0000922 all species →	Cellular Component	spindle pole	Interproscan
GO:0004674 all species →	Molecular Function	protein serine/threonine kinase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005813 all species →	Cellular Component	centrosome	Interproscan
GO:0007052 all species →	Biological Process	mitotic spindle organization	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K08863	PLK4; polo-like kinase 4	EC:2.7.11.21	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Scolanthus callimorphus tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Scolanthus callimorphus, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →