Gene detail

Detailed information of NY_Scal100_v1.7042.1 in Scolanthus callimorphus

Genomic Location: chr6:26538448...26550534
NR annotation: no NCBI-NR hit recorded
Species Scolanthus callimorphus · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

NY_Scal100_v1.7042.1

ATGGTAAACCCACCAAGATCAAGAGGATACCCTGACTTGAAATATAAATTTATACGTGGATTGATCAAAGGGGAGCACCAGCAGCGACGTCATCAATTTCTAAAGCAGGCAGCTGAGTGGACCTCCAAAGCAATAGTCTCCTTGTCTCTTACAGAGGAGCCTGTGCGATCCACAAAGCAGGCCACCAAGCTTGAAGGGATTGGACCCACAATAAGGGCCCGTTTGGACCAGATTTTGAAAGACAATTGGATTAGTGACGAGCCACCTTTACCAGGTAGACACATCAGCACTGGATCTGGCTTGCTTGTTGCTCTTCTCAATGAAAGTGAAGCCCTTGGCTCATCTGAGGGTGGAAAACCTCTAGTTCTAGAGGATGACTTGAAAAAAGCTTGCAGCGACATTTGTGATGAGAAGTTTAACAGTATAAAGCCTTCATCAGATGGAACTCCTGTGATGTGCCCTGCTTGGTGGCGAATTAATGTTCTGATAAGCAGAGGATACATTAAAAAGAAGACCAGAGGGAAAAATCCAGTTTATGAATTATTGCCAGATGGAGAGGAGGTAGCTCGTCGAGTAAGAGGTGAACACATCCCACCACCTAGATACAAGAACTCTGGTTCAGCAAGCCCAGTGAAGTCAGGCACAGTTGAACATCATGGCCCATTGTATAGTTCTGACACAGGGACTGATGGAGTTGTGATGCTGGTTGATAATCATGAGCTTGGAGGTGATGGCGTGCGACTGGGAGAGTTGAGCAGGCGACTGAAGGACTGGGGAGTCACACACAAGACCTGTGCCCTCCCCTGTGGGGATTATCAATGGGTTTGGCGCCAAAAAGGGAAAGAGGTGACATTACCCATCATAGTCGAGCGGAAAAGAGCAGATGATCTAGCCGAGAGCATAAAGGATGGCAGGTACATTCGACAGAAGGACAGAATGCTGGACTGGCGGTCAGGGTTTGGGATTTTGACAGATGAGGTGAGCCTGCAGTACATCCTGGAGTCCACCCCGGAGGCGTATCGAGTCTCGTGTATGGATGGTTGTAATGGTGTAGGGAAGTGTGGCAACCCAAGCGTCCAACAGCTACAGGTGGCGATAGAAGAGCTCCGTAACAACACGGACTTTATGCTGATACAGACTGAAAACATTGAAATTTCTGTCGAATACCTGGCTACAATCACGGCAGACTTACAGCGACGGGTTACTCTCGGCGATTTCGACACTCTTCGGCTTATTCACAGCAATCGATCTTGTACTTCAACTGGGCTTCACAAGCTGCCAGACTTAAAAACAACTAAACCAAGCCCCTCTTCAAGTTCGGTTAATTCTTATAGCGCCAAAGGGCGCTCTTCCGCCACTTCTACCATGCGATATGATGAATTCAACTCACCTCCAAAACGGAAAAGCGATTTGGCTTTGTGTTCAACAAAATATGACAAGTCAGCGACATCTGCGCGAAGTGCAACCTCAGTTAACTCCTCAAGCACGTCTTATTCAAACTGGCTTGAGGAGGATTTCGATTCACCCTCAAAGGAATTCAAGGGTGAGACCTTTCCGTATAGCTCATCATCAAAGAATCGTCAATCAGAGACATTCATGCGTAGTGCACCAAACTCAGCATATTCAACTACTCCAAAGATGACCACAGCGTCAGAAAGAGATTATACCAGCCCTGCATCTAGAAAACGAGCGCCCTACCAAGCTATAGATGTCGATGATTTATTTGACGAATGTACTGAGAAGAAAGCACGCATAGAGTCAGGATATGGCTTGGGTTTCCCAGAGTCCCAAGGAGACGATTTGCTGGAGTCGGTATTCGATCAACCCAGCCCATCGCATTCGGGAGCATCTTCAAATCGCGATTATTTGAAGTGTTTTGATGCAGAATATGAACACAAGGATTTTCAAAATAACAGAGACAAATCTTCCAGATATTCCTGGAACGAAAGCGACGTTAAAGACCACGTTTTGAACCCCGGGCGTTCTAGATTTGCTCCGTCCCGGGTGTCATCATCTCCCTCTTCATTTCCAAGCAAAGGTGGTACCCCTCATTGCGTGAAAGCGGAGGTCTCATCCATCGTGCGAGAAGATGAAGACAAAATTCGCGCTGTACGGGAGGTAATTCCCGACTGTAGTCGTGCCGCGGTCGTGCGCGCTCTTTCCTCGTCTGGTGGTAACGTGGATCATGCTGTAATGATGCTGCTTGATGCCCCTAGTGCGCATTCACGAGCGGAGTTTGTTGATCTTACATGA

Transcript

NY_Scal100_v1.7042.1

Protein

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0013428 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02732 all species →	ERCC4	ERCC4 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027421 all species →	Homologous_superfamily	DNA polymerase lambda lyase domain superfamily	Interproscan
IPR011335 all species →	Homologous_superfamily	Restriction endonuclease type II-like	Interproscan
IPR009060 all species →	Homologous_superfamily	UBA-like superfamily	Interproscan
IPR047416 all species →	Domain	MUS81, XPF-like nuclease domain	Interproscan
IPR003892 all species →	Domain	Ubiquitin system component CUE	Interproscan
IPR006166 all species →	Domain	ERCC4 domain	Interproscan
IPR033309 all species →	Family	Crossover junction endonuclease Mus81	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13451 all species →	CLASS II CROSSOVER JUNCTION ENDONUCLEASE MUS81	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0043130 all species →	Molecular Function	ubiquitin binding	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0004518 all species →	Molecular Function	nuclease activity	Interproscan
GO:0000712 all species →	Biological Process	resolution of meiotic recombination intermediates	Interproscan
GO:0000727 all species →	Biological Process	double-strand break repair via break-induced replication	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006302 all species →	Biological Process	double-strand break repair	Interproscan
GO:0006308 all species →	Biological Process	DNA catabolic process	Interproscan
GO:0008821 all species →	Molecular Function	crossover junction DNA endonuclease activity	Interproscan
GO:0031573 all species →	Biological Process	mitotic intra-S DNA damage checkpoint signaling	Interproscan
GO:0048257 all species →	Molecular Function	3'-flap endonuclease activity	Interproscan
GO:0048476 all species →	Cellular Component	Holliday junction resolvase complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for NY_Scal100_v1.7042.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Scolanthus callimorphus tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Scolanthus callimorphus, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →