Gene detail

Detailed information of PcrG025460.mRNA1 in Podabacia crustacea

Genomic Location: scaffold_69:9477373...9493483
NR annotation: no NCBI-NR hit recorded
Species Podabacia crustacea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

PcrG025460.mRNA1

AAGAGTTCACCTCACAATTGCCCGACCGAGCGCCTGATTGTAATGTTCGATTGTTGAACGCTTACCGACTAAGTTTGTAGAATAGCTTTGATTTACTCAAAATTTAGACATGTTTAGCCTTCAAAGTGTTAGTTTATTAAGAGGAGCCTTTATTAGAAGTGCCAAGTGCCTTCCTGCTGTTCAAAATGCCGCAGCGAAGATGTCCACGAGTTCCGATCCACAAGATCCGTCTTTCACACAAATGTGTGAAGGCTTCTTCGAAAATGCAAGAAGTTACGTGGAACACAGACTTCTAACGAAGCCAGATCCTCCAGGCTACCGCCCAGAAAAGTTCGAGGACAAGAAACACAGAATAAAAGGCACTTTAGATGTTATGAAGCCCTGTGCTGACGTTCTTTCAGTGGTATTTCCAATAAAGCGAGATAATGGTGAATTTAAACTTATCGAGGGTTATAGGGCTCAGCATAGCCATCACAGAACACCATGCAAAGGAGGTATTAGGTTTAGTGATGATGTTGATATTGATGAAGTGCAGGCGTTGGCCACCCTCATGACATTCAAATGTGCTGTGGTTGATGTTCCCTTTGGTGGAGCTAAAGGAGGCATTAAGATCAAGCCTTCAGATTACTCTCAACGTGAATTAGAAAGGATTACACGACGATTTACTGTGGAGCTTGCCAAGAAAAATTTCATTGGACCAGGCCTTGACGTGCCGGCACCAGACATGGGGACTGGGGAGAGAGAAATGAGTTGGATTGCTGACTCTTTTGACATGACATTAGGTTATGGTAACATGAATGCATATGCTTGTGTCACTGGCAAGCCAGTTCATCTTGGTGGAATTCATGGGAGAATATCAGCCACAGGAAGGGGTGTTTTCCATGGAATAGATAATTTTCTTAATTCAGAAAAATATTCTCATTTAGTTGGCTTAGAACCTGGACTCCGTGGAAAAACATTTATAGTTCAGGGATTCGGTAATGTGGGTCTGCATACTTGTCGTTATCTTCACCGTGCTGGAGCTAAGTGCATTGGAATCATGGAGAGAGATGGAAATCTTTACAATGAAGATGGAATTGATCCAAAAGAACTCGAGGATTATAAACTGGACAATGAGGGCTCAATAAAAGGTTTTCCTGGAGCAAAGATGACTGAAGAAAACCTGTTAGAAGCTGAGTGTGACATTTTAGTTCCAGCTGCCAATGAAAAACAAATTACCATTAAAAATGCTCACAAAATTAAAGCAAAGGTCATTGCAGAAGGTGCAAATGGGCCAACCACACCAGCAGCAGAAAAAGTTTTAATTGAAAATAAGAAACTTGTTATTCCAGATATGTATTTGAATGCTGGAGGTGTGACAGTGTCCTACTTTGAGTGGCTGAAAAACATCAATCACGTCAGTTTTGGGCGTCTGACTTGGAAATACGAGAAGGAAGCCAATTTTAATCTTTTAGCTAGTGTTCAAGAAAGCTTGGAAAATCATTTCAAAACACATCCTATTCCCATCCAGCCTTCTGCTGAATTCCTGAATAAGATTGCAGGTGCATCTGAAAGAGACATCGTACACTCTGGATTGGAGTTCACAATGGAACGATCAGCCAAGCAAATCATGCGCTGTGCTGAGGAGTATAACCTTGGACTGGACATTAGGACGGCTGCTTATATTGTATCCATGGAGAAAGTCTACAACACCTACACTGTGGCTGGATTCACATTCACATAATCACCCAAGGATACATTTACCAATAATGAATTACTAGATAATTTTTTTACTGAACTGAACTGAATGAAATTGCTGGGTTTGTATCGTTTGTATGATATTTATTGTAACTGTGTTCTTTGTGCCAGCATTGATCCGTCAAGGGTGATCATGTTGTGCTGGTCATATGAACCCTGTGTGCAGGACTGGGTAATATGATTGATGGCATTGAATTGGTTTGCTTGAGAATGGGAGTTACTGGGCTCTATGTTTTTATGGTAGCCCTGTCTGAGACTGCAATACTTATTCATAATAAAATAAAAAAAATAAATGCACACAAATATAGAAACTTGTCAAACTACGTACGACAATAAAGAAACAAGCTATTTCTCCGTTACTTTAATTCTCTCCAAATGTCAAGATATTTCCACTGACTGCCCAACATCTCAATTTTTGATTTTGTAGTCGCCATCCTAAATGACTATAAAAACATATAAAATTGAAACAAGGAGGAAAAAAATAAAGCTTCATGGCTGTCAAGAA

Protein

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003359 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02812 all species →	ELFV_dehydrog_N	Glu/Leu/Phe/Val dehydrogenase, dimerisation domain	Domain	Interproscan
PF00208 all species →	ELFV_dehydrog	Glutamate/Leucine/Phenylalanine/Valine dehydrogenase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036291 all species →	Homologous_superfamily	NAD(P)-binding domain superfamily	Interproscan
IPR046346 all species →	Homologous_superfamily	Aminoacid dehydrogenase-like, N-terminal domain superfamily	Interproscan
IPR006097 all species →	Domain	Glutamate/phenylalanine/leucine/valine/L-tryptophan dehydrogenase, dimerisation domain	Interproscan
IPR006096 all species →	Domain	Glutamate/phenylalanine/leucine/valine/L-tryptophan dehydrogenase, C-terminal	Interproscan
IPR033922 all species →	Domain	NAD(P) binding domain of glutamate dehydrogenase	Interproscan
IPR014362 all species →	Family	Glutamate dehydrogenase	Interproscan
IPR006095 all species →	Family	Glutamate/phenylalanine/leucine/valine/L-tryptophan dehydrogenase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11606 all species →	GLUTAMATE DEHYDROGENASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006520 all species →	Biological Process	amino acid metabolic process	Interproscan
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan
GO:0016639 all species →	Molecular Function	oxidoreductase activity, acting on the CH-NH2 group of donors, NAD or NADP as acceptor	Interproscan
GO:0004352 all species →	Molecular Function	glutamate dehydrogenase (NAD+) activity	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0006538 all species →	Biological Process	glutamate catabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K00261	GLUD1_2, gdhA; glutamate dehydrogenase (NAD(P)+)	EC:1.4.1.3	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Podabacia crustacea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Podabacia crustacea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →