Gene detail

Detailed information of PcrG029045.mRNA1 in Podabacia crustacea

Genomic Location: scaffold_99:553062...639903
NR annotation: no NCBI-NR hit recorded
Species Podabacia crustacea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

PcrG029045.mRNA1

ATGAGTAAACAAGCTGAAGAAGATGAGTTTATGCATTCTTTTGGAGAGCAGTATGGATATGCTGGAAAAATTGATCAAATTAGAACGAAGGAGTTTAAAAGACTCGAAGATATTACCTACCTAGATCATGCTGGAACAACACAGTATCCACAAAGTGTTATGAGAAACATCTATAGTGATTTAAACAACAACGTGTATGGCAATCCACACAGCAGAAACCCTAGCAGTCAGCTGTCAAGTGACATCACAGAGCAGGTTCGCACTAGAATATTAAAGCATTTTAATACTACTTCAGAAAAACACACTGTGATTTTTACCTCTGGTGCTACTGCTGCTTTAAAACTTTTGTCAGAGAGTTTTGATTGGCAGGTGGCTACAAACAAGGAAAGTTGTCACAGAGGTAGATTCTGTTACCTTGAAGAGAATCATACATCAGTGGTTGGTATGAGAGAAAGAGCTGCTTCAAGTGAGGCGCAAATAATCTGTGTCACTGAGAAAGATTTGATGGAACAACTCAAACTCACAGGTGGAGAGACTAAGAACCATTTGCATTCAAAACTGCTTGATTCTTCAGACTATGAAGATGAAACTAATAGTTCCTTTGTTGAAAGTGTTGACTGTTGCCACAACGTATTTGCCTTTCCTGCAATGTGTAATTTCTCTGGGATAAAGTACCCTTTTGAATGGATTTCTCAAACTCAACAAGGTTCATTGTTCTGTAGTGGTCCTTGCTGTCGTTGGTTTGTTCTTCTGGATGCATCTTCATTTGTAAGCACTTCTCCCTTGGACTTGCAATCTTGTTCAGCAGATTTTGTTCCCATTTCGTTTTACAAGATGTTTGGTTTCCCAACTGGCTTGGGTGCTCTCATTGTAAAGAACGATAGTTCTCACATTCTACATAAATGTTACTATGGAGGAGGAACTGTGCAGGCTACAATTTCTACTGAAAGGTTTCATGTCAACAAGAAAAGCCTTGCAGAAAGATTTGAAGATGGCACTCTTCCTTTCTTGGAAATTGTTGCCTTACATCATGCATTCACTGTATTTGAACAGCTGATTGGATCAATGACAATGGTCTTGAATCACACCCACAGCATTGCTTTCTACGTGTATAAAAAGATGTCTGTAATGACACACAACTCTGGAAAACCATTATGTGTTATATACTGTGACAATGATTTTAATGACAACACAAGACAAGGCCCCATTATAAACTTTAATCTGCTGAGAGCAAGTGGGGACTTTGTTGGATATAGTGAGGTAGATAAGATGGCCAGCTTATATAATATTCACCTAAGAACAGGATGCTTTTGCAACACAGGGGCCTGTCAGAAATTTCTGAACCTATCAAATAAACAAGTGAAGGACAATCTGTCAGCAGGTCATGTGTGTGGGGATGATCTGGATCTCATTGATGGAAAACCTACTGGTTCAGTCAGAATCTCATTTGGGTACATGTCCAACTTTGGTGATGCAAGAAAATTTCTTAATTTCATTGAAGAATGCTTCCTGGAAAGAGACTTAAATGGCACCTCCCTGAGTTTGCACAGTAATGCTGTGTTACCTACAAATTCAATCTTGACTAAACATTACCAGGACACAGCTTCATCTAACTGTCACAAAAACGACATTCACAGCAACTCAGAACAGAATTCAACTGTCCACTCAACACCAAGCCACAAAGATCCTATTAAAGTAATAGATCCTATTGGAAGTACAATCCTTGATGATTTTCAAGCTAACAGTCTCCAGCATTCAAAGAACCTGAGGCTGGAAAAGATTTTCCTTTATCCTATCAAGTCCTGTGCAGCATTTGAGGTCAGTGAGTGGGAGGTTGGTGCAAGAGGTTTTCTTTATGATCGTCATTGGATGATTGTCACAGATTCTGGAGTATGCCTAACTCAGAAGAGAGAACCACGGTTGTGTCTTATTAAACCCACTCTGGATCTTACGAGTAGAATTCTGTCAGTCACAGCACCAGGAATGCCAACTCTAGTGTTGCCGTTGTGCTTGTCATCTGGGTATGAGGATTGCAAAGCAAGTTTTTGTAACACCAAAGTCTGTGGAGACAGAGTCTCAACTGTGGATTGTGGTGACCATGTGGCCTCGTGGATGTCAAGATTTTTATTTAAAAACTGTCGACTAATTCAGCATCATAACAGAGATGCCCGAACTTGTAAGCTAG

Transcript

PcrG029045.mRNA1

Protein

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007027 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00266 all species →	Aminotran_5	Aminotransferase class-V	Domain	Interproscan
PF03476 all species →	MOSC_N	MOSC N-terminal beta barrel domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000192 all species →	Domain	Aminotransferase class V domain	Interproscan
IPR028886 all species →	Family	Molybdenum cofactor sulfurase	Interproscan
IPR015424 all species →	Homologous_superfamily	Pyridoxal phosphate-dependent transferase	Interproscan
IPR005303 all species →	Domain	Molybdenum cofactor sulfurase, middle domain	Interproscan
IPR015421 all species →	Homologous_superfamily	Pyridoxal phosphate-dependent transferase, major domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14237 all species →	MOLYBDOPTERIN COFACTOR SULFURASE MOSC	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006777 all species →	Biological Process	Mo-molybdopterin cofactor biosynthetic process	Interproscan
GO:0008265 all species →	Molecular Function	molybdenum cofactor sulfurtransferase activity	Interproscan
GO:0043545 all species →	Biological Process	molybdopterin cofactor metabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K15631	ABA3; molybdenum cofactor sulfurtransferase	EC:2.8.1.9	Folate biosynthesis	ko00790	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Podabacia crustacea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Podabacia crustacea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →