Gene detail

Detailed information of Ppa0G158980 in Paragorgia papillata

Genomic Location: Contig00227:1828900...1833058
NR annotation: CAB3980835.1, Disintegrin and metallo ase domain-containing 10 [Paramuricea clavata]
Species Paragorgia papillata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Ppa0G158980

ATGGCTGTCTTTATCATTTTATTGTACATCCTAGGCCTCGCTCTGACCACGTCGTGTGGCCATAGACCTTTAAATGAATTTATCAAACACTTCGAACCACTCAACTACAGACCGAAGCGGCCACGCGTTGCAAAAAGATGGACGCACGCTGATCCACATTCGCAATCGTTGGTCATAAAAGCATTTGGAAGGAAAATGTACCTGGACTTACATCGAGATTCGATTAGCTTAGCATCGGATGTACAAGTAGTTGATGGGTATAACAGAAGGATCGGTTTTGGTCGGCATTCTTTCGTCGTTGGGAGATTGAAAGGCGAGGATGGATCGATTGTGAATGGTGTCTTGGCAAGCAGCGGGATATTCACCGGGAGAATTGCTACCAGAGATGACACATATTTCATCGAGCCTGGCCAGCGATACTTCGGCAGTGCTGCGAAATTTCATTCTGTGATCTATCGTGACAGAGATGTGCATTACAACGTGAATATCACGTTGCCTAGGAGAATCACGCGAGATGTGCGTCAACGAGATAAAAATATGCAGTCAAGAACCAGGAGCCGGCGTTTTATAAACTATCATAGCAACGTTTGTCGAATGTCTTTGGAAGCTGATCACACGTTTCTAAAAATGGCAGGAGGTCATTTTTATGCTATCCAAATGATGGTTATACACATCCAAGCTTTAAATGCAATCTTTCGTTACACTTTTAACAACACTGATACATATGCCCCCCATGGCATTCAATTCCAAATCGCCAGGATAAAGGTTTATGTTAACGAGACTGATACCGTGTTAGCCAGAGGAAATCTCGACGCAGCGACTTTTCTTACGTTAATGGATGAAAATGACGATTACTCGGAGTATTGTCAAGCGTTGTTTTTCACATCTAGGTATTTTCTTGGTGGAGTTACTGGTCTGGCGCATACTGGAGGTGCTTGTACGGAGTCAAATACGGCAGTTGTTACGTTTAGACGAGGGAACATGTGGTTGCCTCCCAAAGTTACGGAGCTTGCTGTTGCACACGAAATGGGGCACGCTTTTGGAGCTGAGCACGATCCTAACACAAACGAGTGTCAACCAAACGGAAAAGATGGCAACTACATTATGAAAAGCGATGGTACAAATGACGACCAACATAATAACGCCATTTTTTCACCCTGCAGTGTAAAACAAATGAAACAATTCATAGACAACTCGCGCGGTAAAAAGAACTGCTTTATAGAAAGCTCGCAGAGCACTGAAGATAGAGGAACGCTCTGTGGCAATGGCGTGGTTGATGCCGGTGAAGATATCAATCCAAATGATCGCGAGGAATGCGACTGTGGTGACGAGAAAACCTGCCAAGATATGGAACCTGGTAATTGTTGTAACTTCAGGACGTGCAAACTTAATAAACATGCTGTCTGCAGTCTTTCTAATGGATTTTGCTGTAACGCTACAACGTGCACGTACAAACAAGCCGGAGATGTGTGCATACCAGAACTGGAGTGCTCTCAAGTAGCCACCTGCCCAGGGAATACATCCTCTTGTCCTGACCCACCACCTAAAAAGAACTTCCTAGAATGTAACCGAAATTCCAGCTTGTGCATGAACGGCTCGTGTAGCTTGTCTGTCTGTGTGAAGTTTGGACTAGAGGCCTGCTTTTGCAAGAAGAAGGAAGATCAGTGCAAAATATGTTGTCTTTATGAAGGAAAGTGTCAGGCTGCTAAAGATATTACAAAGATGCAGTCAGAGATTAAATCAGTCTATTTGAGTTCAGGATCTTTATGTTTGGATAATGAAGGCTTTTGCGATGTCTTTCACGACTGTTACATCATAGATACGAAGGGTTTTTATAACCATTATTTTACTAAAGAAGGGGTTAAAGAAGTGACGCATCGATTTTGGTGGGCTATTTTACTGGGAACTGTAGGTCTCATTGGCTGTATATTTCTGACCGTTAAATACGGTGCTCTTTACACGGTGAGCAGCAATCCTTTAGTGAATGAGAAAGAGCCAGCTCGAAAACTGTCGTGGGAAAGATTTTCTCGTTCAAAGAGCGAAGAGCAAAGAGAAATTATAACAATTGAAGACATTTCTTCTTAA

Transcript

Ppa0G158980

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O77633	Disintegrin and metalloproteinase domain-containing protein 10 OS=Sus scrofa OX=9823 GN=ADAM10 PE=2 SV=2
Q10741	Disintegrin and metalloproteinase domain-containing protein 10 OS=Bos taurus OX=9913 GN=ADAM10 PE=1 SV=1
O14672	Disintegrin and metalloproteinase domain-containing protein 10 OS=Homo sapiens OX=9606 GN=ADAM10 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000651 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13688 all species →	Reprolysin_5	Metallo-peptidase family M12	Family	Interproscan
PF21299 all species →	ADAM10_Cys-rich	ADAM10, cysteine-rich domain	Domain	Interproscan
PF00200 all species →	Disintegrin	Disintegrin	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001762 all species →	Domain	Disintegrin domain	Interproscan
IPR001590 all species →	Domain	Peptidase M12B, ADAM/reprolysin	Interproscan
IPR051489 all species →	Family	Disintegrin and Metalloproteinase Domain-Containing	Interproscan
IPR036436 all species →	Homologous_superfamily	Disintegrin domain superfamily	Interproscan
IPR049038 all species →	Domain	ADAM10, cysteine-rich domain	Interproscan
IPR024079 all species →	Homologous_superfamily	Metallopeptidase, catalytic domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45702 all species →	ADAM10/ADAM17 METALLOPEPTIDASE FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004222 all species →	Molecular Function	metalloendopeptidase activity	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0006509 all species →	Biological Process	membrane protein ectodomain proteolysis	Interproscan
GO:0007219 all species →	Biological Process	Notch signaling pathway	Interproscan
GO:0008237 all species →	Molecular Function	metallopeptidase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K06704	ADAM10, CD156c; disintegrin and metalloproteinase domain-containing protein 10	EC:3.4.24.81	CD molecules	ko04090	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Paragorgia papillata tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Paragorgia papillata, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →