Gene detail

Detailed information of Ppa0G165380 in Paragorgia papillata

Genomic Location: Contig00240:1228191...1230527
NR annotation: XP_028404585.1, amiloride-sensitive amine oxidase [copper-containing]-like [Dendronephthya gigantea]
Species Paragorgia papillata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Ppa0G165380

ATGGGTGGAGAACGCAACAACGATTCAAGCGCTCGTTGGAATACCAATATCAAGCTTGTGATCGGTCTTTTGGTTCTGATTTGCCTCGGCTTGCTTGTCGCCGTTATTGTTTTATCTCTGAATAAATCAGAGACCTTAGACGAAGTACCTTTGGCTTGCCCTTCATCGCCGACATCGCGTGGTCCAAGCTTCAGTGATTCCAACGACTTGTTTCGGGATTTGAGCAAGGACGAGATCGTCCATGTTCGCGAATACGTCTTGAACGAAGCTTCGCTTAACGTGACTCCGCACTCGATAGCTTCTATTGCCTCCAACTACATATTTCTCATCGAATTAATGAACCCAGACAAAGACGAAGCTCTCGCTTATCTCGACGGTGGCGGCGGAAAGAAACCCAGAAGGTTAGCCCGTGTAGTCATCTTTAGTGGTGCTCTCACTCCCCCCATCGTCCAGGAAATATTGGTACTCGTCCACGAGCCAAAGAACCATGTAGTACATAGTCCCGGTAGAAAGAATCCTATTCCTTTTCGTTACAGACCTATGGATATCAAAGAAGGTACTGAAATTCAAAACATGGTGGATAAGTTCACACGTACGGCTAGTAAGATGATGTGGGAAAACTTTAGGATGAATTGTAGTAGAAGTTGTGCTCCTTATGTACCTAGTGCCCCGTCTTTGAAACAAGGCGATCGTGCGATATGGATCCATCTACACAGACCCGCCATGGGTGTTACTACACATCCTCTTCCAGTTGAGCTATTTATGCAACTCACTGGCAGTGATGTGCGAAATTGGGCCGTCAAAAAAGTTTTCTACCATAATGTTGTATTCGATTCTGTACAGAACTTCGTGGATAACTATGAGAAGGGAAACATCAGCATGGTTTATCAATCTCCAGCTGGTGAAGGATTTTCGTATTCTAGCTTAGAGCGACGGGGAAATATCGAGCCATCTTCGCCTAAACTAGAGCCCAGGTTTTACGAACCAGGCGGAAAGCGGTACACTGCTGAGGAGAACCACGTGGAGTACATGGGATGGAGTTTTGATTTTCGTATGAGATCGTCTTCGGGTCCGCAGCTGTTCGACATTCGGTTTAATAATACCAGGATTATTTACGAACTAAGCCTCCAAGAGGTTACTGCTTTTTACGGAGGGTTTTCGCCAACACGGTTGTTCTCCGACTACCTAGACAGCAGTTGGGCTTTAGGAAAGTCTTTTGAACTCGTCAAGGGAATTGACTGCCCAGCTACCTCCTCTTACTTTGACGTCATTGCGTTTGTCAATTCTGGCCACGTGACGAGGAGAAAGAACGCTATTTGTGTTTTCGAGCTGAACACGGGTGCTCCCCTTCGTCGCCATTACGAGTTTGATGGACAAGATAGTTATGCGTTCTATGGTGGAATGCCAAATACAGCTCTTGTCTTCAGGACCATCATAACCCCGTATAACTATGATTATACGTATGATTACATTTTTTACCAAAATGGTGTCATAGAAGTGAAGGTAACGTCTGCGGGATATATTCTGTCTGCTTACTGGACAAGCGAAGAAGGTCGTTTCGCGACAAGGGTGCACGAAGACGTTGCTGGTTCTATTCACGACCATATGTTTCACTTCAAGGTCGACTTTGACATTGCTGGAGTTAGAGAAAACTCGTTTGAACTGATCCGTTCCAAGGTCAACAAGACAACAAGATGGTCACTGGATGGCACGTACCACTATGAAAAGTATTTTGAACGCGATCAGAAGAAGACCGAGAAGACCGCCGCCTATACGTACGATTTTCAGACTCCATCTCTCTTGAATTTCTACAACGAAGCGGCCAAAAATTTCAACGGTGTGCGACGTGGATATCGTATTCAGCTGAATGGCATTATGAAGCAGATGTACCCTGAGAACTGGTCGTACACGAGGGGGATCGGATGGTCGTATAACCAGTTGGTTGTTACCAAGTACAAGAAAAACGAAACAAGAAGCTCGACAATTTACAATCAAATGGATTTCTATGATCCCATGGTTGACTTTCGTGAATTTATCGATGACAACGAGGACATTAGCAACGAAGATTTGGTCTCGTGGGTTACTGTTGGCCTAATGCACCTTCCGAGCTCCGAAGACATACCGATAACCACCATCGTAGGAAACTCGGCCGGGTTCTTTCTTCGACCGTACAATTACTTCGACGAAGATCCATCGATGGCCTCGCGCGATGGCGTTGTGATCACGCCAAGTGGAAAAGCATCAAATGTGAAAAGATCGGAAAGAAACGGCCTTTCTTCGTGTGTTTCTCGCGATGAACCAATCATTTATTCGGGCAGGATCGACAAACTCAATTAG

Transcript

Ppa0G165380

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P36633	Diamine oxidase [copper-containing] OS=Rattus norvegicus OX=10116 GN=Aoc1 PE=2 SV=1
Q8JZQ5	Diamine oxidase [copper-containing] OS=Mus musculus OX=10090 GN=Aoc1 PE=2 SV=1
P19801	Diamine oxidase [copper-containing] OS=Homo sapiens OX=9606 GN=AOC1 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000872 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02727 all species →	Cu_amine_oxidN2	Copper amine oxidase, N2 domain	Domain	Interproscan
PF01179 all species →	Cu_amine_oxid	Copper amine oxidase, enzyme domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR015800 all species →	Domain	Copper amine oxidase, N2-terminal	Interproscan
IPR016182 all species →	Homologous_superfamily	Copper amine oxidase, N-terminal	Interproscan
IPR000269 all species →	Family	Copper amine oxidase	Interproscan
IPR049948 all species →	Conserved_site	Copper amine oxidase, TPQ-binding site	Interproscan
IPR036460 all species →	Homologous_superfamily	Copper amine oxidase, catalytic domain superfamily	Interproscan
IPR049947 all species →	Conserved_site	Copper amine oxidase, copper-binding site	Interproscan
IPR015798 all species →	Domain	Copper amine oxidase, catalytic domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10638 all species →	COPPER AMINE OXIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005507 all species →	Molecular Function	copper ion binding	Interproscan
GO:0008131 all species →	Molecular Function	primary methylamine oxidase activity	Interproscan
GO:0009308 all species →	Biological Process	amine metabolic process	Interproscan
GO:0048038 all species →	Molecular Function	quinone binding	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11182	AOC1, ABP1; diamine oxidase	EC:1.4.3.22	Tryptophan metabolism	ko00380	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Paragorgia papillata tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Paragorgia papillata, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →