Gene detail

Detailed information of Ppa0G366500 in Paragorgia papillata

Genomic Location: Contig00531:2851984...2860961
NR annotation: XP_028416937.1, peptidyl-glycine alpha-amidating monooxygenase B-like [Dendronephthya gigantea]
Species Paragorgia papillata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Ppa0G366500

ATGAAGTCATTTCTAGTGTTGTTCGTCTTTACCACATTACTTTACTGTGATACAACTCAAGGAAACACAGCTAAAGTTAAAATAGAAATGCCCAAAGTTCATCCAAACGAGCGAGACTCGTATATTTGTACATCATTGAAACTCCCTGAACATGATTCTTACATAGTTAAATATGAACCAAATGCTCGCAAAGAAACTGTACATCACATGTTACTGTTTGGCTGTGATGAACCTGGTCGTTATCAGAAAGCTTGGAATTGTGGTGATATGGGTGTTGGCACATGTGGAAATTATGAGTCCATATTGTTTGGTTGGGCCAGAGACGCACCATCATTAGACTTGCCAAAGGATGTTGGCTTTAAAGTTGGTGGCGGAAGTAAAATCAAATACTTGGTTCTTCAAATACACTATGCACATCCGTTGGAAGATGGTCAGTATGATTCATCTGGTTTGACATTACATACAACTGACACAAGACAACCAAATGTTGCTTCTATATATCTTTTGTTGGCCTCCCAAGCAGATATACAGCCACATGCTAAAGGAATTCATGTTGATATTGCTTGTAAATATGACAGTGATCAAGAAATTCATGCATTTGCATTTCGAACGCACGCTCATGATTTAGGACGTGTGATTACTGGTTATCGTATTCGAAACAACAATTGGACACTCTTGGGCAAAGGTGATCCCCACGCACCACAGGCATTTTACCCCATGAAAAACATTACCACAATTAAAAAAGGTGATATATTGGCTGCCAGGTGTACTTACGACACATACAATACCGACAGAACTGAAGTGACACACATGGGTTCAATGTCTAGTGATGAGATGTGTAATTTTTATATGATGTACTATCGTGATGCTCAAAGTCATGCTGAAATACCACAAACTTGCATGGACCAGTCTACCTATGAAAACCTATTCCATTCTTTTCCAAGTGACTCCGATGTTGCTTTAAGTTTGTCACCAGGCCACCATCACCATCATCATCACCACCACAGTCAAGATGTCAATGTTGATGAAGACACAGCCAAGAAGTCTGGTATAGACCAGGCTATTAATGCACCTCGTGAGCAGAAGCCTGAGTCTGAGGAGGGTGTGGTCACCAAAGGTAAGACCCAATCTATCAACAATGTTCAAAAAACAGATGATGATACTTTGGGTGGAGTCAGTCAAGAGGAATCGTTGGTGCATGAGCCAAATTACGAACCTCTCAATCCCACTACATCCAGTTTGCTCAATAGCCCAACTGATGATGTCACAAAACCTACTGGTGATGTCACAAAACCTACTGGTGATGCCACAAACCCTACTGATGACATCACAAATCCTACTGATGATGTCACAAACCCTACTGATGATGTCACAAACCTTACTGATGATGTCACAAAACATACTGATGACATCACAAGCCCTACTGATGTCACAACCCACACTGATGATGTAATAAAACCTACTGATGACGTTACGGGTATTGATGACACCACAAACAATACTGATGACGTTACGAACAATACTGATGACATCATCGACAGTGACGTAACAAAAGGAAAATCCCGCTTGTATACCACAGAATACGACATGTTCGGAGAAGTATCGACCACAAGGTCTACGAAAGCTTCTGAACTTGCTGAAGACAAAAGCTCGGATTACGTCACACATGACGTCAGCACTGACGTCAACACTAGTACGTCAGTCTCTGAGCAGACTACGAGTGCGTCTCAGTTGACGTATGAACCAACCACAACTGGACACAAAGGAAAAGAAAATATTGATGAGAGTGATGGAAGTTTTTGGAAAGATTTGAGAAAGAAGACGACGAAAACAACAGCACAGGTCGTCGAGAGCAAGTTCAAGGAGAAAAATGGCGTTGAGGAAGGACACGATTTTAATCTTGGTCCATCGCAAAGCAAATCAGATCATATAGAGGTGCACAATGTATCAGTTGTGAATGGTTGGCCGTCTACTGTTACCAAGAGACTGGGTCAAGTGACAGGTTTAGCAGTGGACTCCGCTGGTCGGTTGTTTGTGTTTCATCGTGGTGAGCGCATTTGGGACATCGATACATTTAATGATGATAATACGTTCCGTCACGCCAGAACGCGTGGAAAAATTCGTGCAGCAACTATTCTAATCCTGGATGGCAAGAGCGGCAAGTTATTAAAGGAATGGGGGCGCAATATGTTTTACTTACCACATGGACTCACCATTGATCAAGACGACAATGTATGGATCACTGATGTTGGTCGGCATCAGGTGATGAAGTTCTCACGCGGGGAGTTCAAAAAACCTTCGTTGATCTTGGGGAAAAATCTTATTCCAGGATCAGATGAAAAACATTTCTGTAAACCTACGGACGTTGCCGTTGAAAAATCTGGAGTATTTTATGTTGCTGATGGGTATTGCAACGGAAGAATAATGAAGTTCTCCGCTAAAGGCAAGCTGCTCAAGGAATGGGGGAGTCCATCTCGTAAATCAGATGCTCGTCCTGGTACTTTCTCTATACCGCACAGCTTGGTTCTGGATGAAAAACACGACATGTTGTACGTGGCTGATCGTGAGAATGGACGCATCCAGTGCTTCGATACGCAGGGAAAATTCCATAAACTGATTTCTTCCAAGAAGTTTGGAGGACGTGTCTTTGCTGTAAATTACAACGACCAAGATGAAGTGTTATATGCAGTTAATGGCCCCGGAAGAGCTGAAGTGCAAGGCTTCACTATTAATCCAACCACTGGAAAAATCCTTGCATCGTGGAGTCCTCATGGCAAGGGTTTTTCTCAACCTCATGATGTGGTTTCAAGTGGCTCGGATATTTACGTTGCTGAGATTGGTCCGAATAGGGTATGGAAGTTGGAAGCAGAACATGAAGTTCAACCCAAAGACGTGAACTATGAACGTGGTTTTGGCAATGAGGCCATCGGCAAGAAACCAACCCAAGCCTCCGACGACGAAAATACGAAGGGCGGCGAGCAACCCCGAAAAGAAGAGAAAAAAAGCAACGTTCCTGCTGTGGTTATTTTGACTATTCTTAGTGTCCCAGTTGTGATCTTGCTTTTGGTTGGTTTAGTCAGTAAAATAAGAGGCAGAAAAACTCTTCACAAATACGATATGATGGACGAAACATTAGGCAATCACTCAACTCCTGGAAATTGGTGTAGTTCAGTGAACTGCTGTTCAAAATCCTACCACAACATGGAGGAATTATACCTAATGGACAGCGATAGTGACTTAGAAATATTTCCCGATGTACACGTCAACAAAAAATGA

Transcript

Ppa0G366500

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P14925	Peptidylglycine alpha-amidating monooxygenase OS=Rattus norvegicus OX=10116 GN=Pam PE=1 SV=1
P97467	Peptidyl-glycine alpha-amidating monooxygenase OS=Mus musculus OX=10090 GN=Pam PE=1 SV=2
P10731	Peptidyl-glycine alpha-amidating monooxygenase OS=Bos taurus OX=9913 GN=PAM PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001140 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01082 all species →	Cu2_monooxygen	Copper type II ascorbate-dependent monooxygenase, N-terminal domain	Domain	Interproscan
PF01436 all species →	NHL	NHL repeat	Repeat	Interproscan
PF20678 all species →	HV_Gp350_C-term	Herpesvirus Envelope glycoprotein GP350 C-terminal	Domain	Interproscan
PF03712 all species →	Cu2_monoox_C	Copper type II ascorbate-dependent monooxygenase, C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR014784 all species →	Homologous_superfamily	Copper type II, ascorbate-dependent monooxygenase-like, C-terminal	Interproscan
IPR001258 all species →	Repeat	NHL repeat	Interproscan
IPR000720 all species →	Family	Peptidylglycine alpha-hydroxylating monooxygenase/peptidyl-hydroxyglycine alpha-amidating lyase	Interproscan
IPR000323 all species →	Domain	Copper type II, ascorbate-dependent monooxygenase, N-terminal	Interproscan
IPR020611 all species →	Conserved_site	Copper type II, ascorbate-dependent monooxygenase, histidine-cluster-1 conserved site	Interproscan
IPR008977 all species →	Homologous_superfamily	PHM/PNGase F domain superfamily	Interproscan
IPR011042 all species →	Homologous_superfamily	Six-bladed beta-propeller, TolB-like	Interproscan
IPR024548 all species →	Domain	Copper type II ascorbate-dependent monooxygenase, C-terminal	Interproscan
IPR036939 all species →	Homologous_superfamily	Copper type II, ascorbate-dependent monooxygenase, N-terminal domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10680 all species →	PEPTIDYL-GLYCINE ALPHA-AMIDATING MONOOXYGENASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016715 all species →	Molecular Function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan
GO:0006518 all species →	Biological Process	peptide metabolic process	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0004497 all species →	Molecular Function	monooxygenase activity	Interproscan
GO:0005507 all species →	Molecular Function	copper ion binding	Interproscan
GO:0005576 all species →	Cellular Component	extracellular region	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24006	PAM; peptidylglycine monooxygenase / peptidylamidoglycolate lyase	EC:1.14.17.3 EC:4.3.2.5	Enzymes with EC numbers	-	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Paragorgia papillata tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Paragorgia papillata, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →