Gene detail

Detailed information of XP_020620228.1 in Orbicella faveolata

Genomic Location: Sc7jCM8_2850:354474...392387
NR annotation: XP_020620228.1, synaptic functional regulator FMR1-like isoform X1 [Orbicella faveolata]
Species Orbicella faveolata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

LOC110057960

ATGGCGTCGAGTGGTTTCGCGCCCAGATTGCGCAATTTGTTGATATCCCAGACTGCCTCTGGGACAGCAGTGCAAGTTGAGCAAGAAAACATGGAGGATTTGTCCGTAGAAGTTTGCGGCAAAAATGGGGCTTATTACAAGGGTTATGTGAGGAACATTCATCAAGACCAAGTCACGATCGCTCTTCAACACGAATTGAATAACTGCAGGAGGGTTGCTTATGAAGAAGTTCGTCTGCCTCCATCTACGAACCAAAGATGTGATTTATATGTGGACGATGAAGTAGAGGTGTTCACAAGAGACAGTGATGGCGAACCGTGTGGATGGTGGCTGGCAAGAATTGTACACAAAAAGGGAGAGTACTATGTTATTCAATATGCTGGATGGGATGCTACTTTTAATGAGATTGTCCCAAGAGAAAGAATTCGTCCAGCTAGTCACAATGGGCCAATTTCCAGGAATATGTACCACAAGGTCATGATTGATGTGCCACAAGATTTGAGACAACTCTGTAAAGATGAAGGGACACATCGAGAATTCAAGAAACAATGTGGTGCATCCTGTGTTTATTATAATGATGAATTAGCTGTTCTTGTTGTGTTGTCTCGTTCTGAACGTCCAGTGAAGTGTGCAGCCATGCTTAGTGAGATTCATTTCAGAAGTCTCAGAACAAAGATGTTGTTACAGTCCTGGACAGATGAGACAGCAAGACAGCTAGAGACGGCAAAGAAACAGATGGGTGTGGTGGACATGCTGACTTTGCCAGATCATCTGATGGGTCTTGCCATTGGTGCTCAGGGTGCCAATATACAACAGGCCAGAAGACTGGCTGGAATTATCTCTATTGAAGTTGATGAGGAAAACTGTACGTTCCATATTTGCGGAGATAGTGAAGCAACTGTTAAGGAAGCCAGAAGGTTATTGGAGTTTGCGGAAGAAACTGTTTATGTGCCCAGACCGCTTGTAGGCAAAGTTATAGGAAAGAGTGGTCGTATTATACAGGATATTGTGGATCGCTCAGGCGTTACCCGTGTCAAGATTGAACCACCAGAGGAAAGATCGTCCATGGAAGAAAAAGCTTCTAAGAAAGAAGTTTCATTCCTGTTCGTTGGAACAAAAGAATGCATCGCTAATGCACGAATGATGTTGGACTACCATTTGTCACATCTTAAGGACGTGGAACTGATGAAAAAAGAGAAAGAAAGCCTTGATCAACAGCTTCGAAGTATGGGCATCAACCCGCCCCAAGGCCCCGCGTACATACCCACACCGGCCGAGATGCGACCTGGGCCGAGTCTCTCATTTATTGGTCAGGACAACATGTTGAGCCTGCGTGACAGGTCGCTGACTTCGGAGAGTTTCGCCGGGGACTTGAGCGAAGGGATGTTCGTTAGCACGAAGGACGGCCCGAAAACCAAGCCGACTATACGAATAAGATCGAGCAGTGAATCCGAACCCCCCGAAAACAAATCTAACTCACAGCAGTCCTCTAAGAATTCTGGAAACCGGCGAGCGTCTACACCGACGTCAGAGCTGAAAGGGATCGTGGAGGAGGAGACTGAGGAGAGTGAGCAAGGCAGGAGTAAGCCTGGGGAGACAGTAAATGAGAAAGAGGAGATTGTAACATCCTCTTCTCCACCAAGAGAAGGAAAGACAAAGAAACCTTTGCCTTGGTTCACGGGAGGCAATCGACGAACGGACAGCGAAGGAAAAGATGACAGAAGAAACGAAGGACAACGGAAAAACAGCGACCACAACGACGCCAGGACAAACCAAAACAACGGTAATAGACAACATGGCCGACAGGACCACAGACAACGAACCGGAAGTAAAAATCAACAACAAAGACAACAATCACAATCAGGTTACAGGCCCCGCGGAAACAGCGGCAACCAATTCCGACCGAGTAGCGGAAGTCTATCGGCGAACTGGAGAGAGCGGTCCCAAGCCCAACCTGAGGCGTCGACCAAAGACAAAGCGAAGGAGGCCGAGAGTAAAAGAGACAGTGAAAGGAATGCGGAACAGAAGGTTAACGTTTCTGTAGTAGAAGAACAAAAGGAGACGAAGGGAGAAGAGAAGGGGAAAGAAAATGGCGATGCGAAGAGCCCGGATGAGAAACCGAGCAGGCCTGTGACTGAGGAGAAGCCAGTTGATACAAACGCGGGGCATACTAAGAGTACGGAGGCAAAAGGGGAATCTGCGCAAGAGAACTGA

Transcript

rna-XM_020764569.1

GTTTTTCACCCAAACATGGCGTCGAGTGGTTTCGCGCCCAGATTGCGCAATTTGTTGATATCCCAGACTGCCTCTGGGACAGCAGTGCAAGTTGAGCAAGAAAACATGGAGGATTTGTCCGTAGAAGTTTGCGGCAAAAATGGGGCTTATTACAAGGGTTATGTGAGGAACATTCATCAAGACCAAGTCACGATCGCTCTTCAACACGAATTGAATAACTGCAGGAGGGTTGCTTATGAAGAAGTTCGTCTGCCTCCATCTACGAACCAAAGATGTGATTTATATGTGGACGATGAAGTAGAGGTGTTCACAAGAGACAGTGATGGCGAACCGTGTGGATGGTGGCTGGCAAGAATTGTACACAAAAAGGGAGAgtaCTATGTTATTCAATatgctggatgggatgctacttTTAATGAGATTGTCCCAAGAGAAAGAATTCGTCCAGCTAGTCACAAtgggcCAATTTCCAGGAATATGTACCACAAGGTCATGATTGATGTGCCACAAGATTTGAGACAACTCTGTAAAGATGAAGGGACACATCGAGAATTCAAGAAACAATGTGGTGCATCCTGTGTTTATTATAATGATGAATTAGCTGTTCTTGTTGTGTTGTCTCGTTCTGAACGTCCAGTGAAGTGTGCAGCCATGCTTAGTGAGATTCATTTCAGAAGTCTCAGAACAAAGATGTTGTTACAGTCCTGGACAGATGAGACAGCAAGACAGCTAGAGACGGCAAAGAAACAGATGGGTGTGGTGGACATGCTGACTTTGCCAGATCATCTGATGGGTCTTGCCATTGGTGCTCAGGGTGCCAATATACAACAGGCCAGAAGACTGGCTGGAATTATCTCTATTGAAGTTGATGAGGAAAACTGTACGTTCCATATTTGCGGAGATAGTGAAGCAACTGTTAAGGAAGCCAGAAGGTTATTGGAGTTTGCGGAAGAAACTGTTTATGTGCCCAGACCGCTTGTAGGCAAAGTTATAGGAAAGAGTGGTCGTATTATACAGGATATTGTGGATCGCTCAGGCGTTACCCGTGTCAAGATTGAACCACCAGAGGAAAGATCGTCCATGGAAGAAAAAGCTTCTAAgaaaGAAGTTTCATTCCTGTTCGTTGGAACAAAAGAATGCATCGCTAATGCACGAATGATGTTGGACTACCATTTGTCACATCTTAAGGACGTGGAACtgatgaaaaaagagaaagaaagccTTGATCAACAGCTTCGAAGTATGGGCATCAACCCGCCCCAAGGCCCCGCGTACATACCCACACCGGCCGAGATGCGACCTGGGCCGAGTCTCTCATTTATTGGTCAGGACAACATGTTGAGCCTGCGTGACAGGTCGCTGACTTCGGAGAGTTTCGCCGGGGACTTGAGCGAAGGGATGTTCGTTAGCACGAAGGACGGCCCGAAAACCAAGCCGACTATACGAATAAGATCGAGCAGTGAATCCGAACCCCCCGAAAACAAATCTAACTCACAGCAGTCCTCTAAGAATTCTGGAAACCGGCGAGCGTCTACACCGACGTCAGAGCTGAAAGGGATCGTGGAGGAGGAGACTGAGGAGAGTGAGCAAGGCAGGAGTAAGCCTGGGGAGACAGTAAATGAGAAAGAGGAGATTGTAACATCCTCTTCTCCACCAAGAGAAGGAAAGACAAAGAAACCTTTGCCTTGGTTCACGGGAGGCAATCGACGAACGGACAGCGAAGGAAAAGATGACAGAAGAAACGAAGGACAACGGAAAAACAGCGACCACAACGACGCCAGGACAAACCAAAACAACGGTAATAGACAACATGGCCGACAGGACCACAGACAACGAACCGGAAgtaaaaatcaacaacaaagacaacaatCACAATCAGGTTACAGGCCCCGCGGAAACAGCGGCAACCAATTCCGACCGAGTAGCGGAAGTCTATCGGCGAACTGGAGAGAGCGGTCCCAAGCCCAACCTGAGGCGTCGACCAAAGACAAAGCGAAGGAGGCCGAGAGTAAAAGAGACAGTGAAAGGAATGCGGAACAGAAGGTTAACGTTTCTGTAGTAGAAGAACAAAAGGAGACGAAGGGAGAAGAGAAGGGGAAAGAAAATGGCGATGCGAAGAGCCCGGATGAGAAACCGAGCAGGCCTGTGACTGAGGAGAAGCCAGTTGATACAAACGCGGGGCATACTAAGAGTACGGAGGCAAAAGGGGAATCTGCGCAAGAGAACTGAACGCATACGGAAGTATTGAGCTCTGCTGATGTAGAAAATTGTACAGACAGATAGAAATTCTATCTACTAAATGATAACAACTAATTTATAAGTGAAAACAGATCTTGTTTATTCAATGTTACGCGCTACTAAAGCCGACCGCCGTGTCCTGcttgtgtttttgttattgtcagAAAGCTCGTCTTTTATCTCATTTCTGAAATCTTCCAGTGAACCACTTTGCACCTTAACGTCTacattgattaatttattgtgacaactttttgttggttttccaaacctttcagccaatcaaagcaCAAACCATTGCACGTGTATCGTTTCTTTGACATCTCAGCCTCACAGACTAACTCTGCTTCTCGATTGGCTAAGGAATAGGCACGTAAGCACTCCATTGATGACCGTTTCCGGTGGCAACCGAACAGGTTGTCATTTAAACGTCTTGGTTAAGGGCTTCACAAGGCTGTTAatactttacttttctttcttttgcttgAAGTTCATGTGTTTCTTCTGTCGCGTAcaattgaaaaggaaaatgacGGCCGGAAAGGACGCAAAGTTGAAATTGTAAGATCTGTAAAGTGATTTTAGATCTAATATTTTTATAAGTTGAAGCAAGTTAAGTCTATGCTCCAGAGGATTAAAAATATTGACATTCAAGTTTaaaggttttgaaaacatttcctcGTGAAATACCGTAAAATACCAAGTTAAAGTCCTGGGCTtgtataacttcataaggggttttgggtgggcttataaacggggaGCTTATACTCGGCGAGATgaaacgtatctgagaaacgaattaaacctaacataccattacatttaaAGCTGTTACCCTATTATCACCCTATTAGCCTATAACCTTCGATTAAAAATGGTGGTGTTTG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6GLC9	Fragile X messenger ribonucleoprotein 1 homolog OS=Xenopus tropicalis OX=8364 GN=fmr1 PE=2 SV=1
P51113	Fragile X messenger ribonucleoprotein 1 homolog A OS=Xenopus laevis OX=8355 GN=fmr1-a PE=1 SV=1
Q2KHP9	Fragile X messenger ribonucleoprotein 1 homolog B OS=Xenopus laevis OX=8355 GN=fmr1-b PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005946 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF05641 all species →	Agenet	Agenet domain	Domain	Interproscan
PF17904 all species →	KH_9	FMRP KH0 domain	Domain	Interproscan
PF18336 all species →	Tudor_FRX1	Fragile X messenger ribonucleoprotein 1, Tudor domain	Domain	Interproscan
PF00013 all species →	KH_1	KH domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR008395 all species →	Domain	Agenet-like domain	Interproscan
IPR040472 all species →	Domain	Synaptic functional regulator FMRP, KH0 domain	Interproscan
IPR041560 all species →	Domain	FMR1, tudor domain	Interproscan
IPR036612 all species →	Homologous_superfamily	K Homology domain, type 1 superfamily	Interproscan
IPR040148 all species →	Family	Fragile X messenger ribonucleoprotein 1	Interproscan
IPR004087 all species →	Domain	K Homology domain	Interproscan
IPR004088 all species →	Domain	K Homology domain, type 1	Interproscan
IPR016197 all species →	Homologous_superfamily	Chromo-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10603 all species →	FRAGILE X MENTAL RETARDATION SYNDROME-RELATED PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0003729 all species →	Molecular Function	mRNA binding	Interproscan
GO:0003730 all species →	Molecular Function	mRNA 3'-UTR binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005844 all species →	Cellular Component	obsolete polysome	Interproscan
GO:0006417 all species →	Biological Process	regulation of translation	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0017148 all species →	Biological Process	negative regulation of translation	Interproscan
GO:0036464 all species →	Cellular Component	cytoplasmic ribonucleoprotein granule	Interproscan
GO:0042803 all species →	Molecular Function	protein homodimerization activity	Interproscan
GO:0043488 all species →	Biological Process	regulation of mRNA stability	Interproscan
GO:0045182 all species →	Molecular Function	translation regulator activity	Interproscan
GO:0045727 all species →	Biological Process	positive regulation of translation	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K15516	FMR; fragile X mental retardation protein	-	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_020620228.1 across 70 RNA-seq samples of Orbicella faveolata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

70Samples

25TPM > 0

4Conditions

65.9Max TPM

12.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
holobiont · control.pH_high.temp	21	8	12.00	57.63
holobiont · low.pH_high.temp	19	4	7.56	62.41
holobiont · low.pH Control.temp	16	6	14.70	65.91
holobiont · control.pH Control.temp	14	7	19.33	64.38

Per sample · hover a bar for the full sample record

Show the sample table (70 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR22214541	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	57.63
SRR22214497	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	56.41
SRR22214501	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	38.77
SRR22214532	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	29.95
SRR22214543	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	27.95
SRR22214542	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	21.38
SRR22214498	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	14.33
SRR22214534	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	5.62
SRR22214496	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214499	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214500	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214502	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214531	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214533	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214536	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214537	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214538	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214539	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214540	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214544	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214545	holobiont · control.pH_high.temp	holobiont	not recorded	control.pH_high.temp	SRP406607	0.00
SRR22214490	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	62.41
SRR22214479	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	52.34
SRR22214482	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	18.71
SRR22214488	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	10.11
SRR22214472	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214473	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214474	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214475	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214476	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214477	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214478	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214480	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214483	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214484	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214485	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214486	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214487	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214489	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214491	holobiont · low.pH_high.temp	holobiont	not recorded	low.pH_high.temp	SRP406607	0.00
SRR22214529	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	65.91
SRR22214526	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	54.86
SRR22214521	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	46.99
SRR22214522	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	24.18
SRR22214494	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	22.11
SRR22214520	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	21.13
SRR22214493	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214495	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214517	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214518	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214519	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214523	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214525	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214527	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214528	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214530	holobiont · low.pH Control.temp	holobiont	not recorded	low.pH Control.temp	SRP406607	0.00
SRR22214507	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	64.38
SRR22214513	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	43.84
SRR22214515	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	41.69
SRR22214510	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	38.34
SRR22214505	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	35.78
SRR22214504	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	27.05
SRR22214514	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	19.47
SRR22214401	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214503	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214508	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214509	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214511	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214512	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00
SRR22214516	holobiont · control.pH Control.temp	holobiont	not recorded	control.pH Control.temp	SRP406607	0.00

Source: CnidoSite RNA-seq expression matrices (OFAVE_TPM, StringTie quantification over 70 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Orbicella faveolata tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	4	XP_020600487.1	0.772390702537577
Negatively correlated	3	XP_020623707.1	-0.385853411705455

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Orbicella faveolata, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →