Gene detail

Detailed information of XP_028418573.1 in Dendronephthya gigantea

Genomic Location: NW_021163627.1:17480...22069
NR annotation: XP_028418573.1, probable ATP-dependent RNA helicase DDX58 isoform X1 [Dendronephthya gigantea]
Species Dendronephthya gigantea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_028418573.1

ATGGTCGAAGGAGAGTGGAAAAACGTTAAACGAAGGGAAAGATACATCAGAGAAGAAATAGATCCTTTGAAATTATTGAGAATTCTTGACGGTGACACTCTGACGAAGTCAGACTGTGAAAATATTCAAGCAGCTTGTATTAATCACGGTCCGATTCATGCAACCGAAAATGAACTTCTCAGACGATTGGAAAAGAGGGGTCCTCAAGCATTCTCGAAATTCGTGAAGGCTCTTCGCGAAACAGGACAAGATCACGCTGCTCAACTTTTAGACCCAAAGTGTGAAGTAACTGGTGCAATCTCAAATGAAAAGCGAGATGATAGAGTCCTTGAAGCAGGAGTTGCTGCAGATATAAGAGTGAAGATATTTCTGTTAGAACCAACTGAGGAACAGGTTAAGGAATTGGAAACATTCTGTGACAGATTTAAAAAATCTCATTTTGATGAGACTGGTAATCTTCGTCAACATTTTAATGGTTTTCTGAGTGAGAATGTTGAAAAGTTTGTCAATCTTGTGAAGTCAACGTATGACATTAAAAGTCAGTTAATTTTGATTTTCCGTTTTTCTGATGTTGATGCAGCCAATACATTTTGGCATGATTTTACCAATGGAAACTTGAAGTCCATTATTAAGGAAAAGCTTCAAAGTTTCCCCTGCCAGAACAACTGTTTCAAAAATGAGGATATACAGTTTGATATTGTGGTTGATGAAGAAGACTTCACAAAAGTTTACAACACTCTTAAGGACCCAAAAGAATATGGTGAGATATTGGTTGATGGTATGGAAAAACAGGAGCTGAAATTGCATGAATACCAGCTTGAGCTTGCAAAACCTGCTCTTGAAGGCAGGAATTCCATCATCTGTGCTCCTACTGGAAGTGGTAAAACATTTGTTGCAATGGAGGTGATCAGGCACATCACTGCAAAACCAGATCACAAGTTTGTGGCATTCATAGTAAACACAGTAAGCTTGGTTGAGCAACAACAGTCATACTTGGAACGATATCTTCCATACTCTGTATCAATATCAAGTGCATGTGGTAGCTATCAGGACATTCATCTTCCAAGTATTTTGAAAGAAAATAATGTTGTTGTGATGACAGCACAGTTGTTATTGAATTGTTTGAAGAAGAAGCCTGCAGTTGATGAAGAAGATCATCCTGGAGGAGTCAAAATATCTCAGTTTTCTCTTCTTGTGTTTGATGAATGTCACCACACAACCAAAGATCATCCATACAATGAGATTATGAGGTGGTACTTGAGACATAAATTTGAGGCTGATTCCCCAATCCTGCCACAGATTATTGGTTTATCAGCTTCTCTTGGTATTGGTACTGGCAATCATGGATCAGGTTCTAAGGCTGAAGAACACATCATGGGATTATTGGCTAATATGGATATCCATGATTTACAAGTATATACCGGAGAATCACAAGACGTCAGTACAAATATCACTCCGATATCACGTGATGAAAGCAACGTATTTCATAGAACAATCGATGATGTCATGTGCAATATTGAAAAGATGCTTTCACCATCTCAATCTTCAGACAGATCCACCTACCAGCATGGTAGTCAGCCCTATGAAAACTGGGTGGTCAAGTTATGCAGTGCAGGTTTAGACAGGGATAAATTAACCTGCGCTGAACATCTCAAGTTCTACAATAATTCACTGATGATGAACATTGAGTTACGTACCGAAGACGCGCTACAATATTTGCGTAAATCTATCAGCCCATTAAACCACGAGCAATCAACAGAGGTTGAGAAAAAACTTGACGAGTTTTTTGTAAACGCAGAGAGAATCATCAAAGAAGATCCCAGTCATTGTGAACCAAACCCTTTTCTGAAAAAACTCGAGACACGATTACAGGAAAAGTTTTCATCTGATGATGGTGGGAAATCAAAAGGGATTATATTCGTGCGAACAAGAGAATCAGCCACAGCTCTGGTTAATTGGATGAAAAATTCGCAGATTTTGAAAGATTTGGTGAAGAATCCAACTTCAGTTATTGGATGTGGTCAGCGGAATGGAAAAGTTGGAATGCCTAAAGCCAAACAAGATAAAGAAATTAAAAGCTTTCGTGATGGTGAATGCAATGTAATTGTAGCAACCTCGGTTCTGTTGGAAGGGATTGATATTCCTGAATGCAATTTCGCTATCAACTATGGCATGCCGGGTAATGAAATTACGTTTATGCAAGCACGGGGAAGAGTCAGATCAAACGATCCTGTTGACTATCAATATGACATCATAGTGCCTCGTGACCAGGTCATGCTCAAACAACGAGACTTGCAAAAAGAAAAATTGATGAACGAAACTATTAAGAAGGTGGAAAAGGAGACAAAGAAGGAAAATTTCCGGGAGAAGGTTGAAAAACGTCAAAGAGTTTACTACGAATATTTAAAGAATCTTACCAAAGCATCCAGTAATGTTAATTTGGTTCCTGAAGATGTCAATTTTCATTGTGTCAAATGTGATACGTTTGCGTGCAAGGCACGTGACATTAAAAAGTTCAGCTCGGCATTTATCGTTCCTAATTATGACAAGAATCTCCACAATGCCATCTTTGAAGAGGTCACTCCAAAAATTATGTGTGGTGGTCTGAATCGGAACAGCAAGACAATTTGCAAGAATTGCAGGCGGGATTGGGGTAACCGAGCAAAGAATGAATTTGGTGAATTCCCGTTGATAAAGATCGAGTCATTTCGTGTAAAAAATTCTTCTAAATCAGTAGATCACTGGTGTAAGAGATGGAAGGAATTTCCTTTCGACCTGGAAACATTCAATCCAGATACAGATCTGAATAATTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6Q899	Antiviral innate immune response receptor RIG-I OS=Mus musculus OX=10090 GN=Rigi PE=1 SV=2
Q9BYX4	Interferon-induced helicase C domain-containing protein 1 OS=Homo sapiens OX=9606 GN=IFIH1 PE=1 SV=3
Q8R5F7	Interferon-induced helicase C domain-containing protein 1 OS=Mus musculus OX=10090 GN=Ifih1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001724 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16739 all species →	CARD_2	Caspase recruitment domain	Domain	Interproscan
PF04851 all species →	ResIII	Type III restriction enzyme, res subunit	Family	Interproscan
PF11648 all species →	RIG-I_C-RD	C-terminal domain of RIG-I	Domain	Interproscan
PF18119 all species →	RIG-I_C	RIG-I receptor C-terminal domain	Domain	Interproscan
PF00271 all species →	Helicase_C	Helicase conserved C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR021673 all species →	Domain	RIG-I-like receptor, C-terminal regulatory domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR038557 all species →	Homologous_superfamily	RIG-I-like receptor, C-terminal domain superfamily	Interproscan
IPR011029 all species →	Homologous_superfamily	Death-like domain superfamily	Interproscan
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR031964 all species →	Domain	Caspase recruitment domain	Interproscan
IPR006935 all species →	Domain	Helicase/UvrB, N-terminal	Interproscan
IPR001315 all species →	Domain	CARD domain	Interproscan
IPR041204 all species →	Domain	RIG-I-like receptor, C-terminal	Interproscan
IPR051363 all species →	Family	RIG-I-like Receptor (RLR) Helicase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14074 all species →	HELICASE WITH DEATH DOMAIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016787 all species →	Molecular Function	hydrolase activity	Interproscan
GO:0042981 all species →	Biological Process	regulation of apoptotic process	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12646	RIGI, DDX58; ATP-dependent RNA helicase DDX58	EC:5.6.2.6	Pattern recognition receptors	ko04054	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Dendronephthya gigantea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Dendronephthya gigantea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →