Gene detail

Detailed information of XP_031550189.1 in Actinia tenebrosa

Genomic Location: NW_022258437.1:86248...103686
NR annotation: XP_031550189.1, vacuolar protein sorting-associated protein 18 homolog [Actinia tenebrosa]
Species Actinia tenebrosa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_031550189.1

ATGGCGTCCATACTGGACCAGTACGAACAGGCTGCTACTGGTGGGGCAGACAGCCTTAACCCTTTCCTAGCATCCGATGATATCGAACCAGTTTCGAGTGGATTTATAGAGATGCAGAGTGATGACATTCCTATTTTTAGGCGTCAAAAGATAAATTTTAGACCACCAAGTAATATTGCTGATTTAGTTGTGTGCAATAACACAGTTGTGGTTGCACTCAGTACCAACTTCATCATGCGAATAGACCTGGCAAACACAAATGAAATTGACACTGTTGAATTGAGTAGAAGGATGGATGATACTATTTATAAGATCTTCTTGGACCCAAGTGCAAGACATCTGATAATTTGTATGAATTCCCAAGAGTCTTATTATCTTGCAAGGAACTCAAAGAAACCAAAACTCCTGACAAAACTGAGGGGTCATCTAATTAGTGCTGTTGCTTGGAACAAGTCAAAGCTAACTGAAACATCAACCCAAACTATATTATTAGGGACAACCAAAGGTTTGTTATTTGAAACAGAAATTGAACCAGAAGAAAAGTTCTTCCAAGGAGGGATCGAAAGGTTTTTGAAACAATTATATGACGTCAATGCCAGTGGTGAAAAAGAAGAGCCTACATGTGGTGTAATGTTTGAGAAACTTTCCAGTCAAGACCGCAAGTATATCATTATGGTAGCAACATTAAGCCGCCTTTACCAGTTTATAGGAGATGTGTCTAATGGAGAAACTGTAGACTTTCTTCCAATGTTTACAGAGTATGAAAATGCTCCTGCACCTTTCCATGAGATGCCAGGAAATCTTGAACATGGTGAATTAAGGTTTTTCTATTCCAAATTCAGGGGAGCACCAAGTTCCTTTGCATGGCTGACAGGAAGTGGAGTTTATTATGGAAAATTGACGTTCACACCAAATGAAAAAATTGACAATATTATTACAGAGTCGAAGCTGCTCTTATATATGCCTTCTGGTGAAAGTAAAGTCCCAGTGCCTCCCTTGGCTATTGGGCTCACTGAATTCCATGCTCTTTTATTAAACAAAGATAGATTTGAAGCTGTGTCTCTGTTGAGTGAAGAGACAGTCTTTGAAGATGTCATGCCACCTAGGTATGGAGTTATGAGAGGAATGTCTATTGACATGGCCAAAAAGACAGTGTGGATTTATTCAGACACAGCCATCTTCCAGTACCATGTTACAAGAGAAAGCAGAGATGTCTGGAAAATGTATCTGAAGAAGGAGGATTTTGAGAGAGCAAAACTCTACTGCAGGGATAATCCTGCAAATCTTGACAAGGTGTTGACCAAGCAAGCAGAGGATTTGTTCCAAAAGAAAAACTACACTGCAGCAGCCAATTGTTATGCCCAGACACAGGTGTCTTTTGAAGAAATTGCACTAAAGTTCATTAAAGTAGAAGAAAAGAAGGCATTAAGAATGTTTCTCATGAAGAAACTTGAAAGTCTTGAACAAAAGGACAAGACCCAGATGACGATGATAGTAATGTGGTTAATAGAGCTATATCTCAACCGCCTTAACCAGCTGAAGGACTCATCTAGCAGTAACCCCTCTGAACATGACAAACTCCAGGAAGAGTTCCGGAAATTCCTGGCCACTACTGTGGTTAAGTCATGCTTGGATCAAAACATGAAAACAGCATATGAACTGATTGCAAGCCATGGAGATGTCGAAAACCTGGTTTTCTTTGCCATGCTGATGCAAGATTATGACCATGTAATCAGCCATCACATCCAGCATGATGATTACCCTGCGGCACTCAACGTTCTTACCAGGCAGACTGACACAGAACTGTACTACAAGTTCTCTCCTGTTCTCATGCAGCACATTCCAAAACAAACAGTGAGCGCCTGGATTGAGAAGAAAGGAGCACTGAATCCCAAAAGGCTGATTCCTTCTCTGGTACATTATCATCAACAAGGGACGTCTGTACAGTTGGAAGAAGCTGTTCGTTACCTAGAATTCTGTATTGAAAGACTTGGCAATCAAGATCAGGCCATCCATAACTATCTCCTGTCACTTTATGTGGAGCTCAAGGATGATGATTCGTTGCTGCGCTACCTTCAAATGCAAGGAACTCATCCAGACAAGGTGTTGTATGATCTTGAGTATGCCCTGAGGCTTTGCTCTGAACACAGCAAACACAAAGCTTGTGTGCATATCTATAGTACCATGGGGTTATATGAAGAAGCTGTAGACTTGGCACTCAAGGTTGACGTTGAACTAGCTAAACTCCATGCCGAGAAGCCTGCAGAAGAGGATGAAGTCCTGAGAAAGAAACTGTGGCTGAGAATTGCAAGACATGTTGTTGAAGAAGATAGAGATGTAAAAAAGGCAATGGAGTTTGTAAATCAGTGTACATTACTGAAGATAGAAGATATCCTTCCATTTTTTCAAGACTTTGTGACAATAGACCATTTTAAGGATGCCATTTGTTCTTCACTACAAGAGTATAATCAACACATTCAAAACTTGAAAAATGATATGCAGGAAGCAACCGAGAGTGCCAAACTTATCAGAACAGACATCCAAGATGTTAGAAACAGATGTGGTATTGTTCCAGCCAATGAGAAGTGCTCTATTTGTTTGTATCCCCTCTTGACCCGGAGCTTCTACTTATTTCAATGTCAGCATGCCTTCCATACAGACTGTTTGGTAAATGAGTTATCACTTCTTCTCAAGGAAAAACAACGAGCCAAAGCTTTATCATTGTACAGTCTCATCTACTCATCTGACCCTGCATATGGGGAAACACCACCAGGCAATTCAGATCAGTCACGAGAAGCTTTAAAGGCTGAGCTTGATGATCTCATTGCAACAGAATGTGTCTTCTGTGGTGACCTGATGATCAAGACTATTGACCAACCGTTCATAACGAATGAAGAATACGAACAGGTGCAAGCAAGTTGGGCATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P59015	Vacuolar protein sorting-associated protein 18 homolog OS=Danio rerio OX=7955 GN=vps18 PE=2 SV=2
Q9P253	Vacuolar protein sorting-associated protein 18 homolog OS=Homo sapiens OX=9606 GN=VPS18 PE=1 SV=2
Q8R307	Vacuolar protein sorting-associated protein 18 homolog OS=Mus musculus OX=10090 GN=Vps18 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003515 (this species only) · gene tree & orthology
Ubiquitin family	E3\|E3 activity RING\|RING · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00637 all species →	Clathrin	Region in Clathrin and VPS	Repeat	Interproscan
PF05131 all species →	Pep3_Vps18	Pep3/Vps18/deep orange beta-propeller domain	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000547 all species →	Repeat	Clathrin, heavy chain/VPS, 7-fold repeat	Interproscan
IPR007810 all species →	Domain	Pep3/Vps18/deep orange, beta-propeller domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23323 all species →	VACUOLAR PROTEIN SORTING-ASSOCIATED PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006886 all species →	Biological Process	intracellular protein transport	Interproscan
GO:0016192 all species →	Biological Process	vesicle-mediated transport	Interproscan
GO:0005768 all species →	Cellular Component	endosome	Interproscan
GO:0006904 all species →	Biological Process	vesicle docking involved in exocytosis	Interproscan
GO:0007032 all species →	Biological Process	endosome organization	Interproscan
GO:0007033 all species →	Biological Process	vacuole organization	Interproscan
GO:0007040 all species →	Biological Process	lysosome organization	Interproscan
GO:0008333 all species →	Biological Process	endosome to lysosome transport	Interproscan
GO:0030674 all species →	Molecular Function	protein-macromolecule adaptor activity	Interproscan
GO:0030897 all species →	Cellular Component	HOPS complex	Interproscan
GO:0048284 all species →	Biological Process	organelle fusion	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20181	VPS18, PEP3; vacuolar protein sorting-associated protein 18	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_031550189.1 across 18 RNA-seq samples of Actinia tenebrosa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

18Samples

13TPM > 0

6Conditions

24.7Max TPM

9.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole organism	5	4	12.09	18.42
Tentacle	4	3	8.44	15.38
Mesentery	3	2	4.30	7.98
Acrorhagi	3	3	17.49	24.72
whole	2	0	0.00	0.00
whole organisim	1	1	14.26	14.26

Per sample · hover a bar for the full sample record

Show the sample table (18 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR3210696	whole organism	whole organism	not recorded	not recorded	SRP070917	18.42
SRR4696535	whole organism	Whole Organism	not recorded	not recorded	SRP092287	17.89
SRR3193648	whole organism	whole organism	not recorded	not recorded	SRP070917	13.53
SRR3206038	whole organism	whole organism	not recorded	not recorded	SRP070917	10.59
SRR2437124	whole organism	whole organism	not recorded	not recorded	SRP063756	0.00
SRR4677522	Tentacle	Tentacle	not recorded	not recorded	SRP092287	15.38
SRR4677495	Tentacle	Tentacle	not recorded	not recorded	SRP092287	10.67
SRR6282389	Tentacle	Tentacles	not recorded	not recorded	SRP124815	7.71
SRR4677502	Tentacle	Tentacle	not recorded	not recorded	SRP092287	0.00
SRR4677492	Mesentery	Mesentery	not recorded	not recorded	SRP092287	7.98
SRR4677488	Mesentery	Mesentery	not recorded	not recorded	SRP092287	4.91
SRR4677518	Mesentery	Mesentery	not recorded	not recorded	SRP092287	0.00
SRR4677507	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	24.72
SRR4677512	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	14.67
SRR4677515	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	13.08
SRR3193284	whole	whole	not recorded	not recorded	SRP070917	0.00
SRR3216075	whole	whole	not recorded	not recorded	SRP070917	0.00
SRR3207346	whole organisim	whole organisim	not recorded	not recorded	SRP070917	14.26

Source: CnidoSite RNA-seq expression matrices (ATENE_TPM, StringTie quantification over 18 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Actinia tenebrosa tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	17	XP_031560017.1	0.886521303532869
Negatively correlated	6	XP_031564986.1	-0.681876473396655

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinia tenebrosa, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →