Gene detail

Detailed information of XP_031559976.1 in Actinia tenebrosa

Genomic Location: NW_022260389.1:163656...170336
NR annotation: XP_031559976.1, atrial natriuretic peptide receptor 1-like [Actinia tenebrosa]
Species Actinia tenebrosa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_031559976.1

ATGAAACTTATGACAATTATCTCTATTGCACAGATATACCTTCTTCACAAACACCTCAAACCTTTGAAGATGAACCTGCTGACTCTACTAGTTCTTGCAACATTCGTACAAACAGTACGAATGATAGATATCAAACTGGGAGTCAACGTCCCCTTCACGGGTACTTGGCCCGGTGGCCCGAAAATGGCTTCTGCTGTTCTCATTGCGATTGACAAAGTTAACAACGATCCATACTGGTTACAAGGTTACAACCTCACTTACGCCATGAAAGACAGCAAGTGTGACCAAAAGCACTCTATTGCAAATTTGATAGATTTTCGCATGGAGCAGCCAGTTGCTGATGCTTTCATCGGACCAGGATGTTCCGTTGGTTGCCTTCCAGGGGGTCATATTGCAGAYCACTGGAACGTGCCAATGGTTGCCTGGGGTTGTGCAGCATCTGCTCTCTCGGACAAAACTTTGTACCCAACCTTTGTTAGGACTGTCGGAACATTCCATGGCATGTCTGATCTCTTCAAGGCTTTTCTCCCAGCGTATGGTTGGGATCGTATAGCTCTCCTGTGCACTACTGAAACTCTCTGGTCGCAAACTTGTAACATCCTTAAAACAGGCCTCGAAAGAAACTCTTCCTTCAGTGCTCCATATTTTGGTAGCTTTGATCCTGCTTCTGTAAGCGATTACACCATCCGAGCAATGCTAAAGACTGCAAGAGAAAAGGCGCACGTGATTCTCATTAGTGCCTATGGAGCTGCAATAAGAAAAATCATGTTGGGAGCTTATGATCTCGGTATGCTGGATGGCACCTACGTTTTTCTTTGCATGGAAAATATATATTCCGCGTGTCAAGGAGGAAGTGATGGAAGGGATACAGAAGCATGTGAAGCATTTAAAGGACTCATAAACATCAATTTCTACATACCAGAGGGAGAAGCGTACAACAACTTTACATACGAGGTCTGGAGGCGTATGCCTGAGGTTGGATACAATTTATCATCCCCAAGTGATGTTAATATGTACAGCGCTTTTTTACACGATTCTGTCTTGGTGTACGCGCATGCTCTAAACAAGACATTGGACCAAGGTGGAAACTACACAGATGGAAGGACTATCACTCAAAATATGTTTGGCTTAGAGTTTCTTGGTGAAACCGGGCCACTTGGCATCGACAACAATGGAGATCGGGTCACTTCCTACCAGCTTCAGATTTGCAAGAACTCTACTTTCGTACGTTTTGCAAACTTTTTTGGAACAACGAAGCAGTACCTTCTCTTGAATGAAACTGTCATCTGGCCTGGTGGAGGCACCGCAGCACCCCTTGGACGTCCAATTTGTGGCTTTGATGGGGAGCTTTGCCCCCCGGAAGTCGTAGAGGAAGTCGCAACATGGCCTTACATCCTTGTTGGAGTGATCATTTTTGTTCTAACTGTCGGTGGGCTGCTAGGATTCCTTATGTGGCAAAGGAAGAAACATTTTGAAGCTGAGCTTTTGGCGCAACACTGGCGAATCAAGTATGAAGATATCAAATGGCCGCAAACGAAGAAGCAATTTGGTAGCAGGAGGAGTATGATGAGTGTGGGAAGAGGTGAAGCAGGGTCCGAAGGTGGAGAACTCAAAGGCCAAGTTTTCACTACACTGGGAACATACGAGGGTAACTATGTAGCAGTCAAACAGATCTTAAAGCCCAGTTTGAATTTGACGCGAGATATTCTAGTGGAGTTAAAAGAGATGCGAGATCTTCATCACCAAAATGTTAACCCTTTTGTTGGAGCATGTGTGGAATCACCAAACATCTGTGTTGTCCAAGGTTATTGTGCCAAGGGAAGCTTGCAGGACGTATTACACAACGATAACCTTAAGCTGGATTGGATGTTTCAGCTGGCTATTGCTTCAGATATAGCTAGAGGAATGCACTACCTTCACAACAGTCAAATACAAGTTCACGGAAACCTGAAGTCTTCTAATGTTGTTATCGATAACCGTTGGACATGTAAAGTAACTGATCACGATCTCAGGCTATTCAAGGCTGGCCAACAAGAAGATGTTGAAGCTGGAGTCAACGCCAAATACTACGACAATTTGTGGACGGCTCCAGAACACATTTTCAACGAGGAAATCCCATGCTCACAAGCCGGAGACATTTATGGCTATGGAATCATCTTGTCAGAGCTCGTTTGTCGAGGGCTTCCGTATAGCATGTATAAAGATCTTGACCAGAAAACGATCGTTGAACGCGTGCACAAAGGACAAGAGCCACCCTTTCGTCCTCGTATTACTGCTGATTTGGTGGGTCATCCTTTGTATATTCAAATGGCGAAGAACTGTTGGGCCCAAAACTCTCATGTGCGACCAAAGTTCAGCGAATGCTTAAAAACACTCAAGCAGATGAACAAGGGAAAGGAAATCAATATCATGGACAACATGATTGCTATGATGGAAAAGTACACAGATCATTTGGAGGATATCGTAGCAGAAAGGACCAAAGAACTGCAGGAAGAGAAGAAAAAGACAGATGAGCTGCTATTCAGGATGTTGCCAAGGAGTGTAGCAGAAGAACTCAAGCGAGGGCATCCTGTTACTGCCGAAACTTTTGACATGGTCACAATTTTCTTTAGTGACATCGTGGGCTTCACGAAACTTGCTTCACAGAGCACCCCTCTTCAGGTGGTTGATCTTCTCAACGATTTGTACACTGCTTTTGACGATATTATCGATATGCATGATGTCTACAAGGTTGAAACAATTGGAGATGCCTACATGGTTGCCTCAGGCCTGCCCAACAGAAATGCAAACCGCCATGCCGGTGAAATTGCTAACATGTCGCTCGATTTGCTGGCATGTATGTCAAACTTCAGAATACGCCATCTCCCTGACCAACAACTCCAACTCCGTGTTGGAATTCACTCAGGTTCATGTGTAGCAGGAGTTGTTGGTTTAAAGATGCCGCGCTACTGCTTGTTTGGAGACACTGTTAACTATGCTTCACGAATTGAGTCAAGTGGGTTAGCTCTACGTATTCATGTTAGTCCTGAATGTAAACAGATATTAGACGAACTTGGTGGATACCACCTTGAGGAACGCGGTGAAGTTAGTATGAAGGGCAAGGGCACAATTTGTACCTATTTCTTGAACGGTCGCGACGGATTTACCAAGCCTCTTCCTGATCTGGCCTTACAAGCAGGACTTGACGAACATACTTTCAAATAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P18293	Atrial natriuretic peptide receptor 1 OS=Mus musculus OX=10090 GN=Npr1 PE=1 SV=2
P18910	Atrial natriuretic peptide receptor 1 OS=Rattus norvegicus OX=10116 GN=Npr1 PE=1 SV=1
P16066	Atrial natriuretic peptide receptor 1 OS=Homo sapiens OX=9606 GN=NPR1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000157 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07714 all species →	PK_Tyr_Ser-Thr	Protein tyrosine and serine/threonine kinase	Domain	Interproscan
PF01094 all species →	ANF_receptor	Receptor family ligand binding region	Family	Interproscan
PF07701 all species →	HNOBA	Heme NO binding associated	Domain	Interproscan
PF00211 all species →	Guanylate_cyc	Adenylate and Guanylate cyclase catalytic domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001245 all species →	Domain	Serine-threonine/tyrosine-protein kinase, catalytic domain	Interproscan
IPR001054 all species →	Domain	Adenylyl cyclase class-3/4/guanylyl cyclase	Interproscan
IPR050401 all species →	Family	Cyclic nucleotide synthase	Interproscan
IPR029787 all species →	Homologous_superfamily	Nucleotide cyclase	Interproscan
IPR001828 all species →	Domain	Receptor, ligand binding region	Interproscan
IPR011645 all species →	Domain	Haem NO binding associated	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR028082 all species →	Homologous_superfamily	Periplasmic binding protein-like I	Interproscan
IPR018297 all species →	Conserved_site	Adenylyl cyclase class-4/guanylyl cyclase, conserved site	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR001170 all species →	Family	Adenylyl cyclase class-4/guanylyl cyclase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11920 all species →	GUANYLYL CYCLASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0009190 all species →	Biological Process	cyclic nucleotide biosynthetic process	Interproscan
GO:0035556 all species →	Biological Process	intracellular signal transduction	Interproscan
GO:0001653 all species →	Molecular Function	peptide receptor activity	Interproscan
GO:0004016 all species →	Molecular Function	adenylate cyclase activity	Interproscan
GO:0004383 all species →	Molecular Function	guanylate cyclase activity	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0006182 all species →	Biological Process	cGMP biosynthetic process	Interproscan
GO:0007168 all species →	Biological Process	receptor guanylyl cyclase signaling pathway	Interproscan
GO:0016849 all species →	Molecular Function	phosphorus-oxygen lyase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12323	ANPRA, NPR1; atrial natriuretic peptide receptor A	EC:4.6.1.2	Protein kinases	ko01001	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_031559976.1 across 18 RNA-seq samples of Actinia tenebrosa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

18Samples

3TPM > 0

6Conditions

0.1Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole organism	5	2	0.05	0.14
Tentacle	4	1	0.01	0.04
Mesentery	3	0	0.00	0.00
Acrorhagi	3	0	0.00	0.00
whole	2	0	0.00	0.00
whole organisim	1	0	0.00	0.00

Per sample · hover a bar for the full sample record

Show the sample table (18 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR4696535	whole organism	Whole Organism	not recorded	not recorded	SRP092287	0.14
SRR3206038	whole organism	whole organism	not recorded	not recorded	SRP070917	0.11
SRR2437124	whole organism	whole organism	not recorded	not recorded	SRP063756	0.00
SRR3193648	whole organism	whole organism	not recorded	not recorded	SRP070917	0.00
SRR3210696	whole organism	whole organism	not recorded	not recorded	SRP070917	0.00
SRR4677495	Tentacle	Tentacle	not recorded	not recorded	SRP092287	0.04
SRR4677502	Tentacle	Tentacle	not recorded	not recorded	SRP092287	0.00
SRR4677522	Tentacle	Tentacle	not recorded	not recorded	SRP092287	0.00
SRR6282389	Tentacle	Tentacles	not recorded	not recorded	SRP124815	0.00
SRR4677488	Mesentery	Mesentery	not recorded	not recorded	SRP092287	0.00
SRR4677492	Mesentery	Mesentery	not recorded	not recorded	SRP092287	0.00
SRR4677518	Mesentery	Mesentery	not recorded	not recorded	SRP092287	0.00
SRR4677507	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	0.00
SRR4677512	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	0.00
SRR4677515	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	0.00
SRR3193284	whole	whole	not recorded	not recorded	SRP070917	0.00
SRR3216075	whole	whole	not recorded	not recorded	SRP070917	0.00
SRR3207346	whole organisim	whole organisim	not recorded	not recorded	SRP070917	0.00

Source: CnidoSite RNA-seq expression matrices (ATENE_TPM, StringTie quantification over 18 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Actinia tenebrosa tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	34	XP_031566223.1	0.999986973681332
Negatively correlated	3	XP_031553178.1	-0.556833067623359

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinia tenebrosa, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →