Gene detail

Detailed information of XP_031560739.1 in Actinia tenebrosa

Genomic Location: NW_022260633.1:60062...78575
NR annotation: XP_031560739.1, aryl hydrocarbon receptor nuclear translocator homolog isoform X2 [Actinia tenebrosa]
Species Actinia tenebrosa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_031560739.1

ATGGATCCTACGGAGAGTTTTGTGTTTTCTAATGATGGAGTTGATGATGGTCTGGATGAATACGAGAACGACTCCGGCGATAAATCTTCTCATGGAAGGTTAAGGAAGCGTAAAAGCAACGTTTCATTACTAATGAAAGACGAGGAATCGGACGATGATGATTCTGAAAAGCCAGAAAGTAAAATTTCCAGACAAGGTGGTGATTCTGATAATATTAAGGATAAATTTGCAAGAGAAAATCACAGTGAAATTGAACGCAGAAGAAGAAATAAAATGAATGCATACATCAATGAGTTGTCAGACATGGTACCGTCGTGTACTGGACTGGCCAGGAAACCYGACAAACTAACAGTCCTGAGAATGGCAGTAAATTACATGAAGACACTCAGAGAGACGACAAAAGAAGAAAGATTAGCTCCTCAGGATGTGAACTACAAGCCTTCCTTCCTCTCAGACCAGGAGCTGAAACACTTGATCCTAGAAGCAGCAGATGGTTTTCTGTTTGTAGTTAATTGTAAAACAGCAACAGTTGTTTACGTATCTGATTCCATTACTCCCGTATTGGGTCAAGCACAGAATGCTTGGATGAACCAGTCATTGTTTGATTTAATCCATCCTGATGATATTGAAAAAGTAAGGGAACAGTTGATGTCCACAGATTCGCCCGATGCCGGTAGAGTTCTGGATATTAAAACTGGAAATGTGAAACGAGAGGGACATGGAGGACACCAACGTACACAAGTAACATCCAGAAGAAATTTCATTTGTCGGATGAGATGTGCAGAATTACCTGAAGAACAAGCAGCAGAATCAAGGGGTAAAGAATCTTTCAAACTACATGCGTTGGATGAAGAGTATGCTGTGGTACACTGCACTGGATATCTAAAGAATTGGAACCAAAATGGCAACTATCCTGGAGACGACAATTCATCCATGTCATTGGTCACRATTGGACGGCTGCAGCCTGCTAGCATACCTCAGAGTACTGACCTTGTTGACACCCCTACTGTTACGGAGTTCATCTCAAGGCACAGCCTAGATGGCAAGTTTACCTTTGTCGACCAAAGGGTGACAGAAGTCATGGGRTATCAGCCTCAAGAACTGCTAGGGCAGCTCTGCTTTGATCTCTTCCATCCTGAAGATCTAAAACACATGACAGAAAGCTTTGAACAAGTTATTAAACTAAAAGGTCAGACACTATCAGTTCGTTACCGGTTCCGGAATAAAGCTGGAGAATGGGTTTGGACMAGGACAAGTTGTTTTAGCTTTCAAAATCCATATACTGATGAAGCAGAGTACATTGTCTGCACAAACAACATAGTGAGCAACTTTCAGATAGAGACGTCATTACCACAGATCATGGCAAGCCCAAGCTTGTCATCCAGGGGAAGTAATGGTCCCTACAGCACCAACAGTGCTGGCTCTGATTTCTCTCAGCTTTCACCGGCAAACAGTCTTACAAGTCCTGAAATACAACAGCAACAAATCCTACATCAACAGGCMTTACAGCACCAGAGAAGTGCTGCCAGTCAGGCCATGCCTGGCGAGGACAATATTTTYCACTTTCCTGGACAATCTAAAGGTGCACATCATGTATCAGAGAGTGGATTGGATGCACTAGCAAAGGCTGGTGAACTTAGTGAGAAAAGAGGTTTAACGTCAAYGATCAAAGGAAGTCCTGTAGATATCTCAGCCAATCAAATGAATCAACCCAACATGAGCTATAAAGAAACAACCCTGAACCGTGGTGTTTCCCAGGAAGGACCTGGACAAAATGGTACAGGGATGCTTCCACCAGGTGTTGACCAAGGATCCAAGARTACCACAGATTTAGACAAGACATTGGATTTCTCTACTGGCCAGGCAGGCAGCTTACTCGCTGCCTTAGTTCAGCGCCGGCAGGCTTTGGCAGCAGCTTCGGGCRTTTCCACAACAATAGCTACCTCCACTATTCCTCAAGCAGCACTCTACAGTCAGCTTATGTCACAAATGAACGGAGGAATGACTATGTTGCCACCAGGAATGGGTAGAATGATGCAGCAACAAGGAGGAATGGGACAAATGTCACCAGTTGACATGATGAGAGGGCAACAASCTGCTAGTGCCGCTGCCATKGGTGACTTAAGTCCTGGCACATCTATGCCATACAGTGGTGGTGCTAGAAAAGTTGATTCCAGAGACATGCCACAGGTATCCCAGAAAGGGTCTTATTCCCATCTTCTGTCAGAGAATATGAATCGTAGTGTCTCCTCAGTACCTTGGCCTGGAATGCTCAGTGGACAAATGGAGGGCAGCTCGTCTAGTAACAGCCCTCAGTCTTCTGGTATGTACGGTCAAGTTAAYGCWCCAAATACTTCCAGTGGCCGCAGCACTGCAAGCAATTATCCCTACTATCAGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O15945	Aryl hydrocarbon receptor nuclear translocator homolog OS=Drosophila melanogaster OX=7227 GN=tgo PE=1 SV=3
P79832	Aryl hydrocarbon receptor nuclear translocator OS=Oncorhynchus mykiss OX=8022 GN=arnt PE=1 SV=1
Q9BE97	Aryl hydrocarbon receptor nuclear translocator OS=Bos taurus OX=9913 GN=ARNT PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001019 (this species only) · gene tree & orthology
Transcription factor family	bHLH · all TF in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00010 all species →	HLH	Helix-loop-helix DNA-binding domain	Domain	Interproscan
PF14598 all species →	PAS_11	PAS domain	Domain	Interproscan
PF00989 all species →	PAS	PAS fold	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001067 all species →	Family	Nuclear translocator	Interproscan
IPR000014 all species →	Domain	PAS domain	Interproscan
IPR035965 all species →	Homologous_superfamily	PAS domain superfamily	Interproscan
IPR011598 all species →	Domain	Myc-type, basic helix-loop-helix (bHLH) domain	Interproscan
IPR050933 all species →	Family	Circadian Clock Transcription Factors	Interproscan
IPR001610 all species →	Repeat	PAC motif	Interproscan
IPR036638 all species →	Homologous_superfamily	Helix-loop-helix DNA-binding domain superfamily	Interproscan
IPR013767 all species →	Domain	PAS fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23042 all species →	CIRCADIAN PROTEIN CLOCK/ARNT/BMAL/PAS	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003700 all species →	Molecular Function	DNA-binding transcription factor activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005667 all species →	Cellular Component	transcription regulator complex	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0046983 all species →	Molecular Function	protein dimerization activity	Interproscan
GO:0000978 all species →	Molecular Function	RNA polymerase II cis-regulatory region sequence-specific DNA binding	Interproscan
GO:0000981 all species →	Molecular Function	DNA-binding transcription factor activity, RNA polymerase II-specific	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan
GO:0034751 all species →	Cellular Component	aryl hydrocarbon receptor complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K09097	ARNT; aryl hydrocarbon receptor nuclear translocator	-	Transcription factors	ko03000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_031560739.1 across 18 RNA-seq samples of Actinia tenebrosa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

18Samples

17TPM > 0

6Conditions

47.1Max TPM

25.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole organism	5	5	31.43	47.06
Tentacle	4	4	24.98	36.62
Mesentery	3	3	14.26	15.46
Acrorhagi	3	2	16.17	24.55
whole	2	2	30.97	31.20
whole organisim	1	1	43.36	43.36

Per sample · hover a bar for the full sample record

Show the sample table (18 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR3210696	whole organism	whole organism	not recorded	not recorded	SRP070917	47.06
SRR2437124	whole organism	whole organism	not recorded	not recorded	SRP063756	34.14
SRR3206038	whole organism	whole organism	not recorded	not recorded	SRP070917	31.74
SRR4696535	whole organism	Whole Organism	not recorded	not recorded	SRP092287	25.30
SRR3193648	whole organism	whole organism	not recorded	not recorded	SRP070917	18.89
SRR4677502	Tentacle	Tentacle	not recorded	not recorded	SRP092287	36.62
SRR4677522	Tentacle	Tentacle	not recorded	not recorded	SRP092287	26.47
SRR4677495	Tentacle	Tentacle	not recorded	not recorded	SRP092287	26.27
SRR6282389	Tentacle	Tentacles	not recorded	not recorded	SRP124815	10.55
SRR4677518	Mesentery	Mesentery	not recorded	not recorded	SRP092287	15.46
SRR4677488	Mesentery	Mesentery	not recorded	not recorded	SRP092287	14.22
SRR4677492	Mesentery	Mesentery	not recorded	not recorded	SRP092287	13.10
SRR4677512	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	24.55
SRR4677507	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	23.97
SRR4677515	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	0.00
SRR3193284	whole	whole	not recorded	not recorded	SRP070917	31.20
SRR3216075	whole	whole	not recorded	not recorded	SRP070917	30.75
SRR3207346	whole organisim	whole organisim	not recorded	not recorded	SRP070917	43.36

Source: CnidoSite RNA-seq expression matrices (ATENE_TPM, StringTie quantification over 18 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Actinia tenebrosa tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	15	XP_031568720.1	0.877503737668952
Negatively correlated	22	XP_031572383.1	-0.646477150094442

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinia tenebrosa, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →