Gene detail

Detailed information of XP_031561169.1 in Actinia tenebrosa

Genomic Location: NW_022260753.1:78787...92269
NR annotation: XP_031561169.1, dual specificity tyrosine-phosphorylation-regulated kinase 1A-like isoform X2 [Actinia tenebrosa]
Species Actinia tenebrosa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_031561169.1

ATGGAGGAGGCTGGAGTTGGGAAAGGGGGAACAACAAAAGGTAAATATGATGGACAAACTCCAGCAACAAATGTTATTCCCAACATGAATTGTGTGATGTCAAGCACTCTAGAGGATCAAACAGATGATGTAGACTTTGCTGGAGTGCAGAGCTTGTATAGCAGAATTCCAACAAAGTTTAGGGATCCAAGTGGAGCTCCATTACGAAAATTAAGTTTGGATTTAATCAAGACGTATAAACAGATTAATGAGGTTTATTATGCAAAAAAAAGGCGAAGAAAAGAGCAAGAAAAAAGTGAAGAAGTTGGCCACAAAAAAGAGAGACGGTTGTACAATGATGGCTATGATGATGAGAATTATGATTACATTGTTAAAGTTGGTGAAAAATGGTTTGATCGCTATGAAATAGAATCCCTGATAGGAAAAGGCTCCTTTGGACAGGTTTGTAAAGCTTACGATCATCAAGAAAAAGAACACATAGCCGTGAAAATCATCAAAAATAAGAAACCATTTCTAAACCAAGCTCAAATCGAAGTCAGACTACTGGAAATAATGAACAAGCACGATCCAGAAGGAAAATATTACATAGTTCGCTTAAAAAGACACTTTATGTGGCGAAATCACTTGTGCTTAGTGTTCGAACTGCTTTCTTACAATTTATACGACTTATTACGAAACACGAACTTTAGAGGAGTGTCTCTTAATTTAACTCGTAAATTCGCCCAGCAAATGTGTACAGCTTTGCTATTCTTGTGCACGCCTGAACTAAGCATTATACACTGCGATCTCAAGCCAGAAAATATTTTATTGTGCAATCCAAAAAGAAGTGCAATCAAGATCGTGGATTTTGGGAGCTCCTGCCAAATAGGATCCAGGATCTACCAGTACATTCAAAGTCGGTTTTACCGTTCTCCAGAGGTCCTTCTTGGCATTGCTTATAACCTTGCTATCGACATGTGGAGCCTTGGATGTATTCTCGTAGAGATGCACACGGGTGAACCGCTGTTTAGTGGTGCTAACGAGTTCGATCAAATGATGAAGATTGTCGAGGTTTTAGGAATCCCTCCCAAGGAGATATTGGACGAAGCACCAAAAGCAAGGAAGTACTTCGAACGGTTAGCTGACGGTTCGTACGCGTGTAAAAAAAGCAAGGACGGCAAAAAGGAATATGTTCCTCCAGGCACTCGTAAACTTCACGATATTTTAGGCTGTGAAACTGGCGGCCCCGGTGGCCGGAGGCTCGGTGAGCCGGGTCATTCTTTACAGGACTATTTAAAATTTAAGGACCTTATTCTTCGAATGTTGGACTACGATCGAAACTCTCGAATAAMGCCTTATCAAGCATTGCATCATTGCTTTTTCAAAAAGACTGCTGAAGAAGGCACAAATACGACACATTCGGCCACCTCYTCYCCAGCTCAGGGATGCACTACTGCTAACCCAACAAGCACAACAAGCACGAGTACTGCTGACACTCGCGCATGCTCAGATCCAACAGCACACGCTTCTGTTACGGCTTCAGCGATGGAATGCGATAGCCCAAGCAGCAAAGGCCAGCAAGCATGGAGCAATACGGGCTCTAATTTTAAGCAAACAGTTGAAATAACGCCCTCAAATGATTCAGAATCAAGAGGTGCAACTCAAGCGCTTCATATGACCGCTTCAAATACTTGCAGCGARGGTTCATCAGCATACAGCTCGGCATCTGGTGACGTGGGTCGCAGCCAAGGGCGTAATTATGGACCCGGTTCACGAGTATATTATAGCTCAGAAACTATGTCAAATTTCTCGTCTTCGAGTTCATGTAATTCGATGAACATGGAACAACCTCTGCCCATAGGATCTGGTATAACTTCTGCGGTAGGTTCAGCAGAGTTATGTAGTAATCGTARTTACCCGCCAGYCCCACAAGCTCAAGATGCGAACTATTCAACGTCTACAAATAATACATACGAATATTATTCATCGGGATCCAATGCTCTGCCTCAGCGGGGAATCAATCGGAGGGACATTGTACAACAGCATTCCACTGGTGAAGATTCTCCTATGGTATCTGGATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q61214	Dual specificity tyrosine-phosphorylation-regulated kinase 1A OS=Mus musculus OX=10090 GN=Dyrk1a PE=1 SV=1
Q63470	Dual specificity tyrosine-phosphorylation-regulated kinase 1A OS=Rattus norvegicus OX=10116 GN=Dyrk1a PE=1 SV=2
Q13627	Dual specificity tyrosine-phosphorylation-regulated kinase 1A OS=Homo sapiens OX=9606 GN=DYRK1A PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000783 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00069 all species →	Pkinase	Protein kinase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR008271 all species →	Active_site	Serine/threonine-protein kinase, active site	Interproscan
IPR044131 all species →	Domain	Dual specificity tyrosine-phosphorylation-regulated kinase 1A/1B, catalytic domain	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR050494 all species →	Family	Serine/threonine and dual-specificity kinase	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24058 all species →	DUAL SPECIFICITY PROTEIN KINASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0004712 all species →	Molecular Function	protein serine/threonine/tyrosine kinase activity	Interproscan
GO:0046777 all species →	Biological Process	protein autophosphorylation	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0003713 all species →	Molecular Function	transcription coactivator activity	Interproscan
GO:0004674 all species →	Molecular Function	protein serine/threonine kinase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0018105 all species →	Biological Process	peptidyl-serine phosphorylation	Interproscan
GO:0018107 all species →	Biological Process	peptidyl-threonine phosphorylation	Interproscan
GO:0045893 all species →	Biological Process	positive regulation of DNA-templated transcription	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K08825	DYRK1; dual specificity tyrosine-phosphorylation-regulated kinase 1	EC:2.7.12.1	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_031561169.1 across 18 RNA-seq samples of Actinia tenebrosa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

18Samples

18TPM > 0

6Conditions

77.8Max TPM

34.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole organism	5	5	35.18	63.85
Tentacle	4	4	62.08	77.75
Mesentery	3	3	8.32	9.51
Acrorhagi	3	3	31.87	35.83
whole	2	2	23.78	24.85
whole organisim	1	1	22.80	22.80

Per sample · hover a bar for the full sample record

Show the sample table (18 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR2437124	whole organism	whole organism	not recorded	not recorded	SRP063756	63.85
SRR4696535	whole organism	Whole Organism	not recorded	not recorded	SRP092287	55.61
SRR3210696	whole organism	whole organism	not recorded	not recorded	SRP070917	21.99
SRR3193648	whole organism	whole organism	not recorded	not recorded	SRP070917	19.02
SRR3206038	whole organism	whole organism	not recorded	not recorded	SRP070917	15.45
SRR4677495	Tentacle	Tentacle	not recorded	not recorded	SRP092287	77.75
SRR4677502	Tentacle	Tentacle	not recorded	not recorded	SRP092287	74.81
SRR4677522	Tentacle	Tentacle	not recorded	not recorded	SRP092287	64.00
SRR6282389	Tentacle	Tentacles	not recorded	not recorded	SRP124815	31.74
SRR4677492	Mesentery	Mesentery	not recorded	not recorded	SRP092287	9.51
SRR4677518	Mesentery	Mesentery	not recorded	not recorded	SRP092287	8.05
SRR4677488	Mesentery	Mesentery	not recorded	not recorded	SRP092287	7.40
SRR4677507	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	35.83
SRR4677512	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	31.60
SRR4677515	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	28.17
SRR3193284	whole	whole	not recorded	not recorded	SRP070917	24.85
SRR3216075	whole	whole	not recorded	not recorded	SRP070917	22.70
SRR3207346	whole organisim	whole organisim	not recorded	not recorded	SRP070917	22.80

Source: CnidoSite RNA-seq expression matrices (ATENE_TPM, StringTie quantification over 18 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Actinia tenebrosa tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	29	XP_031567053.1	0.945869851312016
Negatively correlated	15	XP_031549766.1	-0.8086216705282

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinia tenebrosa, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →