Gene detail

Detailed information of XP_031564458.1 in Actinia tenebrosa

Genomic Location: NW_022261358.1:152473...154553
NR annotation: XP_031564458.1, uncharacterized protein LOC116299881 [Actinia tenebrosa]
Species Actinia tenebrosa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_031564458.1

GGGCATAGTGAATCCATCAGGGTTGCTACTGTTACACCGAATGGAGCTGCAATCGTTTCAGGGTCAGAAGACCGCACCTATAAGATATGGAATTTAAGCTCGCTACAAGATGTTCCGGCTTTTATTGGTCATAAACAAGGAATAAATAGCTTGGATGTGTCACGGGATGGACGTCTCTGCGTCACAGCATCAGAAGACTCATTRCTAAAGGTGTGGAATTGTGAAGAGTTCAAAGAGGTTTGTGCTCTATCTGGTCACGAAGGAGGCGTCCTCGCTGTCACACTACACCCTAATTACCCTTTTGCAGTATCCGGAGGGAATGACTGCACCATTAGAATATGGAGTGTTGAAGGTTTCCATGAAACAARTTGCCTCAGAGGTCACCAACATCCAGTCCAAGTGGTATCTTTTAATGAAGATGGGAGTGCTTTTGTAACAGGAGGTAGAGATAACACGATTGGCGTGTGGGATTGGGCCAGTAAGAGTATCCATGCCTGGCTGAAGGCTCCTATATTTGATATTACCCACATAACTATGAACACTCACTGCCTCCTGGTGGGTAACAATCGACACTCTGTTTGGAAATATGCAGTTGACAAAGAAAAGGCCGCAAAGATCATGAAGCTTGGAGATATCGATTTSCTGAAAATGGTGAAAGAAAGAAAGCGATGCGAGGAAGAAAATGGCTCTTTTGTTGGAGACCCCTTACAAGGAACAAAAAGAGAAATTCCAAATGGATGTGTTCCATCCTTTTGTTCATTGTTCACGTCTTCGGTGTCCATTGGACCCGACAGYAGAAGTCATCCTACCCTGTTGATTAGAGATGGAACGCGGCTCTTGTTTGGTAGTGTCATGAGCACTATGCCATTGCGTTTCTTAGATGTTGAAACAGGAATGGATAGTGGTCTCCAGATTGAYAAAAATGGGAAAACGCTCGTTACCGCTCTTGCTACGCACAGTGACGAAAAGGAGGTGCTTGTTGGTACAGATCAAGGGAACATCATAAGAATTGAACTAGAATCGAATGAGATTTTACAAACGTATGAACAAAAGCAAGTTCCTGGATTCTCCAAGAACGCATCTGTTACGGGGCTTGCCACATCAGAAGATGGAAAATTCTTCCTCTCAGGRAACTCTGACGGAGAACTGTTGCTTTGGGATGTTGAAAAAGTTGAAGGAAAACTTCTCAAATCCTGCCTGCTGAGAATCAGTGGCGTTTGTTTTTTAAAGGAGGACAGTTTTGCTGCTGCTGACGAGAACGGGTATCTTCACGTTGTATCGAAAGATGGCCCAAATCTCTCCATTCTTGCTCACGACACCGCTGTAACAACTATTACATCGCGTGGCATTCCCTCAGAAAACAGCACTCGATATCTCGCTACAGCCGCATTGGGAACTTTGAAAATTTGGAGTGTGAGTCAGCATGGTTGTGCACTACATTGCGATCGTCAAATTAGTTGTTCTGGTCTTAACATAAGAACAGTTCACTTTCTCCCAAACTGTRCATCGCTCCTTACTGGCTCCGATGATAACGTTGTTAGGCTGTGGGACGTGAAAAATAMAAATATTTTGAAGACATTTGAGGCCCAGAGCTTTGGCATTAACTATGTGTCTAGCATCAAAGACAGGGTGATCGCTTGTTTTGATGATAGTTCTGCAATAACCTGGTCKCTGGAGACTGGAAACTTGTTAGGTCGAAGTCAAGGGCATCATGGGCGATACCACGTGATCAGGACACTTCCGCTGAGTAACCAAGCCATCACAGATGGTTTTCACTATACGCTGAAACGCTGGAGTACTGAACAAGGCACGTGTTGGTACGAACTGCCGGAACCGTTGGCGGAATATCAGCATTCGAATGAAGTTACTGCTCTAGCAGTTACGTGTGATAGGAGTCTTTTGGTCACGGGGACTCGAGACAAGATGCTCAAGYTATGGATGGTAGACAGCGGRSAATGYTTGAGTGAGTTCTACTTGGAGCATAGTGCACAGGTGATCGCTTGCAGTGCTGAAGGACGCATCTTTGTTGGACTAAGTGACGGGCAGCTTTGCTTCATGAAATTACGAAGTGGAAAATAA

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006514 (this species only) · gene tree & orthology
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR020472 all species →	Repeat	G-protein beta WD-40 repeat	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR011047 all species →	Homologous_superfamily	Quinoprotein alcohol dehydrogenase-like superfamily	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR019775 all species →	Conserved_site	WD40 repeat, conserved site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR19848 all species →	WD40 REPEAT PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_031564458.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_031564458.1 across 18 RNA-seq samples of Actinia tenebrosa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

18Samples

10TPM > 0

6Conditions

20.3Max TPM

4.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole organism	5	3	2.45	7.69
Tentacle	4	4	11.55	20.28
Mesentery	3	0	0.00	0.00
Acrorhagi	3	2	5.70	13.33
whole	2	0	0.00	0.00
whole organisim	1	1	6.85	6.85

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR4696535	whole organism	Whole Organism	not recorded	not recorded	SRP092287	7.69
SRR3210696	whole organism	whole organism	not recorded	not recorded	SRP070917	3.17
SRR3206038	whole organism	whole organism	not recorded	not recorded	SRP070917	1.39
SRR2437124	whole organism	whole organism	not recorded	not recorded	SRP063756	0.00
SRR3193648	whole organism	whole organism	not recorded	not recorded	SRP070917	0.00
SRR4677495	Tentacle	Tentacle	not recorded	not recorded	SRP092287	20.28
SRR4677522	Tentacle	Tentacle	not recorded	not recorded	SRP092287	16.97
SRR4677502	Tentacle	Tentacle	not recorded	not recorded	SRP092287	6.20
SRR6282389	Tentacle	Tentacles	not recorded	not recorded	SRP124815	2.75
SRR4677488	Mesentery	Mesentery	not recorded	not recorded	SRP092287	0.00
SRR4677492	Mesentery	Mesentery	not recorded	not recorded	SRP092287	0.00
SRR4677518	Mesentery	Mesentery	not recorded	not recorded	SRP092287	0.00
SRR4677512	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	13.33
SRR4677507	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	3.78
SRR4677515	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	0.00
SRR3193284	whole	whole	not recorded	not recorded	SRP070917	0.00
SRR3216075	whole	whole	not recorded	not recorded	SRP070917	0.00
SRR3207346	whole organisim	whole organisim	not recorded	not recorded	SRP070917	6.85

Source: CnidoSite RNA-seq expression matrices (ATENE_TPM, StringTie quantification over 18 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.