Gene detail

Detailed information of XP_031568863.1 in Actinia tenebrosa

Genomic Location: NW_022261559.1:70071...84070
NR annotation: XP_031568863.1, acyl-CoA dehydrogenase family member 11-like [Actinia tenebrosa]
Species Actinia tenebrosa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_031568863.1

ATGGAGGACCAGGTTGGAGAAGTGAGAAAAGAGCACCAATTTGACAAAACTAAGCTGCACAGATATCTCAATCAAAACCTACTAGGGTTTCCGAAAGGTGATGGCGAGCTACTGATTTATCAATACAGATCTGGCCAATCCAATCCTACTTTTAAGTTAAACAAGAATGGTTGCTTGTTTGTACTTAGAAAGAAGCCTCCTGGAAGACTTTTGAAGGGAGCTCATATGGTGGATAGGGAGTTTAGAGTGATGTCAGCACTCTTTCAAGCCTCCTTTCCAGTACCGAAGCCTTTGTTGTATTGTAGTGATACCAGCGTAATTGGAACTGAATTTTACATCATGGAACATGTTCAGGGACGTATATTTCGTAATCCATCTCTTCCTGCAGCATCAATCCATGAACGACATCAAATACACAATGCAATGATATCAACATTAGCTCATCTTCACAGCATAAATTGGGAGAGAATTGGACTTTCTGACTTTGGCCACCATAGCAAGTACTTACAAAGACAGACATCGACGTGGAGTAAGCAATATGATGCTTCAGCTACAGCCAACATACCAAGCATGGAGAAGTTAAAAAACTGGTTACATTCCAATATCCCTCAGGATACATTTAAGACAGTGATTGTTCATGGTGACTTTCGCCTGGATAACATCATTTTCCATCCAACTAAATTTGAAGTTATTGCAGTCCTTGACTGGGAATTGGCTACGCTTGGTCACCCTGTGTCTGATCTTGCCTATACATGTCTGCCTTATCATTGGCCCAAACAGATGCCCTTTCAGGAAATGTCTTTAAATGGTGTTACAGGAATCCCATCTGAAGCAGACTGTATTTCCATGTACAGTAATAATGCTGGCCTCATAATTACTAAAGATGTTTGGACTTTCTGCCTTGCTTTAAACTTCTTCAAGTATGCATCAATAGCACAGGGGGTATATAAGCGCTCACTTCAGGGCAATGCAAGTGCACCAAATGCCTCGATATTTGGCAAGGTTGTGGAGCCATTATCAAAAGCTTCCTTCAAAATAATAGAAGACAACAGGTCTACTGATGCTGATGACTTACAAATACCGCCAGAGTTTAACATGCTTCACATATCTTCAAAAGCCAGGCACATGTATGTCAAAATGAAGAAATTCATAGACGATTACATTTTACCAGCAGAAAAAATTTTTTTAGAACATTCATCTAACCTGTCGACACAGTGGACCATTCACCCCTATCTTGAAGAACTTAAGGAAAAGGCTCAAAAACTTGGTCTTTGGAACCTCTTTTTACCTGCACAATCGGGCTTATCACAGCTGGATTATGCATTATTAGCTGAACTTTCTGGCAGATCACCTTACGCTCCTGAAGTATTCAACTGCAGTGCACCAGATACTGGAAACATGGAGGTTCTTCACTTGTATGGTTCCCCTGAGCAGAAGACCATGTGGCTTGAACCGCTACTACAGGGAAAAATACGGTCAGCCTTTTGCATGACTGAACCTGGTGTTGCGTCATCAGATGCCACAAACATGGAATGTGAGATAAGAAAGGAAGGAAAATATTACGTTATTAATGGACGAAAATGGTGGAGCAGTGGTGCTGGAGATCCAAGATGTAAAATAGCCATTGTCATGGGTGGATCTAGGGATAAAGACTTACCACGACACAGAAGACACTCGATGGTTCTTGTTCCTCTTGATACTCCTGGCGTAACGAAAATCAGACCGCTTCAGATATTTGGCTATAACGATGCTCCTCATGGTCACTTAGAGATTGTTTTTGATAATGTTCGAGTCCCTGCAAGTAACATGATCCTTGGGGAGGGTCGTGGTTTTGAGATTGCGCAAGGTCGTCTTGGTCCGGGACGGTTGCATCACTGTATGCGGTCCATTGGATTGGCTGAACGTGCTCTCGAGCTTCTTTGTGAGCGAGCATTGGACAGGGTTGCATTTGGTAAAAGACTTGCAGAAAAGGGAATTGTGCAGGAACAAATCAGTTTATCAAGGATGGAAATCGACCAAGCACGCTTGCTGGTGCTCAAAGCCGCTTACATGTTAGATACAATGGGTAACAAGGCTGCTAGAAAAGAGATCGCCATGGCCAAGGTAGTAGTTGCCCGAATGGCTTGCCGGGTAATTGATCGTGCGATTCAGGTGCATGGTGGGAAGGGAGTTTCACAGGATTCACCGCTGCCCTACTTTTATGCGTTGGCACGTTCGTTACGAATTGCTGATGGACCGGACGAAGTGCATATGGAAGCTGTGGCGAAAATGGAGTTAAAACAACACCTGAAGTCTAGAATGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
B3DMA2	Acyl-CoA dehydrogenase family member 11 OS=Rattus norvegicus OX=10116 GN=Acad11 PE=1 SV=1
Q5R778	Acyl-CoA dehydrogenase family member 11 OS=Pongo abelii OX=9601 GN=ACAD11 PE=2 SV=2
Q709F0	Acyl-CoA dehydrogenase family member 11 OS=Homo sapiens OX=9606 GN=ACAD11 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001320 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00441 all species →	Acyl-CoA_dh_1	Acyl-CoA dehydrogenase, C-terminal domain	Domain	Interproscan
PF02771 all species →	Acyl-CoA_dh_N	Acyl-CoA dehydrogenase, N-terminal domain	Domain	Interproscan
PF01636 all species →	APH	Phosphotransferase enzyme family	Family	Interproscan
PF02770 all species →	Acyl-CoA_dh_M	Acyl-CoA dehydrogenase, middle domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR046373 all species →	Homologous_superfamily	Acyl-CoA oxidase/dehydrogenase, middle domain superfamily	Interproscan
IPR009075 all species →	Domain	Acyl-CoA dehydrogenase/oxidase, C-terminal	Interproscan
IPR037069 all species →	Homologous_superfamily	Acyl-CoA dehydrogenase/oxidase, N-terminal domain superfamily	Interproscan
IPR041726 all species →	Domain	Acyl-CoA dehydrogenase family member 10/11, N-terminal	Interproscan
IPR013786 all species →	Domain	Acyl-CoA dehydrogenase/oxidase, N-terminal	Interproscan
IPR002575 all species →	Domain	Aminoglycoside phosphotransferase	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR050741 all species →	Family	Acyl-CoA dehydrogenase	Interproscan
IPR006091 all species →	Domain	Acyl-CoA oxidase/dehydrogenase, middle domain	Interproscan
IPR009100 all species →	Homologous_superfamily	Acyl-CoA dehydrogenase/oxidase, N-terminal and middle domain superfamily	Interproscan
IPR036250 all species →	Homologous_superfamily	Acyl-CoA dehydrogenase-like, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48083 all species →	MEDIUM-CHAIN SPECIFIC ACYL-COA DEHYDROGENASE, MITOCHONDRIAL-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016627 all species →	Molecular Function	oxidoreductase activity, acting on the CH-CH group of donors	Interproscan
GO:0050660 all species →	Molecular Function	flavin adenine dinucleotide binding	Interproscan
GO:0003995 all species →	Molecular Function	acyl-CoA dehydrogenase activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0033539 all species →	Biological Process	fatty acid beta-oxidation using acyl-CoA dehydrogenase	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11730	ACAD11; acyl-CoA dehydrogenase family member 11	-	Lipid metabolism	-	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_031568863.1 across 18 RNA-seq samples of Actinia tenebrosa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

18Samples

13TPM > 0

6Conditions

14.9Max TPM

6.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole organism	5	4	6.96	14.89
Tentacle	4	4	6.92	9.58
Mesentery	3	2	6.02	11.08
Acrorhagi	3	0	0.00	0.00
whole	2	2	12.09	12.84
whole organisim	1	1	8.74	8.74

Per sample · hover a bar for the full sample record

Show the sample table (18 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR2437124	whole organism	whole organism	not recorded	not recorded	SRP063756	14.89
SRR4696535	whole organism	Whole Organism	not recorded	not recorded	SRP092287	9.80
SRR3210696	whole organism	whole organism	not recorded	not recorded	SRP070917	5.70
SRR3206038	whole organism	whole organism	not recorded	not recorded	SRP070917	4.40
SRR3193648	whole organism	whole organism	not recorded	not recorded	SRP070917	0.00
SRR4677502	Tentacle	Tentacle	not recorded	not recorded	SRP092287	9.58
SRR6282389	Tentacle	Tentacles	not recorded	not recorded	SRP124815	6.59
SRR4677495	Tentacle	Tentacle	not recorded	not recorded	SRP092287	6.14
SRR4677522	Tentacle	Tentacle	not recorded	not recorded	SRP092287	5.35
SRR4677492	Mesentery	Mesentery	not recorded	not recorded	SRP092287	11.08
SRR4677518	Mesentery	Mesentery	not recorded	not recorded	SRP092287	6.97
SRR4677488	Mesentery	Mesentery	not recorded	not recorded	SRP092287	0.00
SRR4677507	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	0.00
SRR4677512	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	0.00
SRR4677515	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	0.00
SRR3216075	whole	whole	not recorded	not recorded	SRP070917	12.84
SRR3193284	whole	whole	not recorded	not recorded	SRP070917	11.34
SRR3207346	whole organisim	whole organisim	not recorded	not recorded	SRP070917	8.74

Source: CnidoSite RNA-seq expression matrices (ATENE_TPM, StringTie quantification over 18 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Actinia tenebrosa tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	9	XP_031557398.1	0.814736377382483
Negatively correlated	38	XP_031560505.1	-0.840655131459956

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinia tenebrosa, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →