Gene detail

Detailed information of XP_031572100.1 in Actinia tenebrosa

Genomic Location: NW_022261744.1:24404...43889
NR annotation: XP_031572099.1, uncharacterized protein LOC116306186 isoform X1 [Actinia tenebrosa]
Species Actinia tenebrosa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_031572100.1

ATGAGAGTTCTATTTGGATTGCTCGTTTACTTCCTCTTTTGTGGGACCTTACAAGGGGTACAGGATTATGAAATAACTTATCCCGAACGTCTACACAGCACGCGTCATCGAAGAGATCTTTCAACCGCTGTCGATGTTGGACATGAGCATTCTGTTCAATTTGCAATTAAAGCTTTTAATAACAAATGGATTCTTGATGCAAATATTAACGAACGAGTTACACCACAAACGGTGCTTCTGCGTCAGTTTGATGCTGATAATTCTGAGATCATTACTCAGGAATCACTAGATAATTGTTACTACCAAGGCTCTATTAAAGGTATTCCCCAATCTATTGTGGCATTAACTACTTGTAATGGCTTGAGTGGAGTGATTGACGATGGAGTTGAAACGTACCACATAGAGCCCCATGCAAACTACGAGGACACAGGAGCACACAAAATATATCCAGCAAAAAGAAGAAAAGAATATGGCGTTCCCGAAGAACCAGATTTCTACAACAAAGCAATGTACGGAAATGGTGAATCCCTTGTCACAAAACCGATTTCAAGGTTACGTCGCAATGTGGCCAATGTAGAAGACCAGTACAAACCATACCTAACGACAAACGAGACTCGATACAACGAGATCTTTTTTCTTGTGGATGACGGCATTTACCAGAGGTTTGGGAATAGTACTAAAACAGTGGTAGAAAGAGTTGTTACTCTGTGCAATGTTTTGGATGCGATTTACCAAAGGATAAACATTCGCATTGTCATGTCTGCCATTGAGATATGGACAAATGGACCTCGTTTTCCTCGCAACGTAGGAGATCTTAAGCTATTTGGTGAATACTTACACAAAGAAGTTAAAGGGAAAATCACCTATGATAATGCCCATTTTATGAGCCATATTGCTTGGCCTGGTGCAGCTGGTGTTGCTTATGTTGGGACAATGTGTGAGCCAGCATCTTTAGCTGTGAACACTTGGAAGTATGCGTGGGGTAGTCATATTGGACCATACGTAGTGGTTGCTCACGAAATGGGACACAATTTTAATTTCCCACATGCTTACACCGATGAATGCAAGTGTCTTTCTCCGAAGGGATGCGTAATGCAATTGTACCCAAGTCCTCGAGTTCTTGGATTTACGGAGTGCAGCTTGAATGGCTTGAAGAAAATTAACGACCGTTGCCTTTATAACGTGCCTACAAAGGCTATCAATTCCAAATGTGGCAATGGGATTCGAGAAGGAAACGAAGAATGCGACTGTGGAACACCCGAGATGTGTAAAGCAAAGGACCCTTGCTGCATGCCACATGACTGTCGTCTAAAGCCTGGAGCACTTTGCAGTGATCTACATCACTCCTGTTGTAAAGACTGCTTATTCAAGAGACAAGGAACACTTTGCAGACCAGTAAAGACAGATTGTGATGTACCAGAATTTTGCCCTGGAGATTCTAGAGATTGTCCAGCTGACATATCCTTACAAGATGGAACCCCATGCAACAGAACAAATAAGTTGCTTCCAGGCAACACCAACTGGTACAGTGTTGTAGCAAGTGAACTATCTCCTCACATAGAAGCACGTCATGTTCGAATCAATCCTCAGTATTGGCATAAATGGATTTGCATGCGTGCAGAACTATATGGCTGTTCTGCTGACGAAGCTAATGCAGCCATTCCTACACCTCTAAAACCCTACAACAACTACTGTATCGTGCCTCAAGATCAAAAATGCATCCCAGAAGAAAACACAAAAGTGATCTTCAAATACGGATATGAATGTAAGGAAGAGTATATGAAATTCAGACTAGATACAAACGGAATACTGTGGCATCATTGCAGTGGGAGAAGAGTTTGTCCTGAAAACGGGAACACGCAGAATGGCGCGAGGTTGGTCATTAGTAGTTCGTGTAAAGACGAAGATTCCAAGTTTGTCCGAACACCAAAGAGGTCGCTCAAGCATGTGGGAAGTGGAAAGTGCATCCACCCAATAGGAGCCTGGCCGGCTGATGGTCGACATCTTGGACTTTGGGCTGGGTGTGGACTACAGCGACTTGAGATTTGGTTTATTAAACCAGACTGCATTTATCCATTGTGTATGCAGAATTTGAAAATCACAAACGAGCAGATCACAGCATCGTCATCGCGGCACTCGGAGCGTCCTTATCATGGTCGTTTGCACCTGGCTAGCTTCTGGTGTGCTGCACAGCAAAAGAAATCAGAGTACTTACAGATTAACTTTAACAAGACAATGAGGATATCCAAAGTTGCCATACAAGGACGAGGAAACTGGTACAACTGGGTTACGGGCTACTTTGTATACTATAGTCAAGATGGACAGCGTTGGACTGGGTACAGTGAAAGTGGAGATAGTGCACACTCGAACTCTTACTGCTTTACTGGTAAGTGCGCAGAGACGAGAAATACCCAGTGCAGAGACCTTTGGGGACCTAAAAGTGAAAGTGCGAATCATGCCTGCTATGAGAAGCTGAACACAGAAGCAAAGGGATACGGAACGTGTGATGCCACGACCAATTCATCCTGCTCAGCTGCTGATGCTGTTTGTGGTCAAATTCAATGCTCGACAAAAAATGCAAGGCCTGGGGTGGATTATGGTAAAAGTTACAAGCAAATTACACTTAATGATGCAAGTGCTTCTCGATGCAGCGCCGCGGTACTCAAAACGTCCGATATGGTTGGTCAAGGAATGGTGAAGGATGGAACAAAATGTGGCGACCAAAAGATGTGCATGAATTCTAAATGCAAGTCGTTCCGAGAGCTAAACATCACCAACTGTCCATCAGCAAACGGCCTCGAGTGTAACGGGAGAGGGAGGTGTACAAGTCTTGGCACTTGTCATTGTCACTCTGGATATGATCCTGAAACCGCGTGTGAAAAAGTCTTTCAACCGATTGATGGAGGCTTCACCCCATGGACTAACTGGTCTATATGTGACAAGGGCTGTGATACGGGCAAACAGAGTCGCCATCGATTCTGCACCAATCCTGCTCCAAAGCACGGCGGCAAGGATTGCCAAGGCATGAAGCAACAGGAGCAGCAGTGTAACGAGGTTCCTTGCCCAAAGGCCCATTCATGCCGTCATCTTCAGACGCAAGCAATCTCTAACAACTTAGATCTTCCGGATGCAATTTACACGATCTATCCCCATGGGCTTTCCAGTAAACCTATCTTAGCCTATTGTGACATGTCACGTGACGGAGGTGGTTGGACGCTATTGGTCACCAGCCGAACCAATACCTGGACTGATCAAAATATCATACTCAGAAACGTAATGTCACCTTCTCTATCTCAAGACTACTCGATACTCAAGTATGCTGATGATATCAAAAATAACATCAATGTCGTTGGAACTACTTTTGAATATCGACTAGAAGCTCAAACACGAGGTCGTTGGGGTGGAATATGGCAGGCAGATCGATCTTACACATTTACAGCGACTACAAATGCTCAAACTAACGTCAAGCTCATTAAAAAATTTGATGACTGGGATTATGCAGACAATGGGATAGAAAAACGAATGCCTTGGATCAAACGAATACCTCGAATTAAGTTTGGAATGCTAACCACATCCGGGGATCCTTTCTTAAACTATTGGGGTACCATTGCAGCACCATATAAACGTTCCCATCCCGCACCGTGGATTGATGGGCACTTGAAAGAAAGAAACCCAGGTGTCATCTGGTACTGGATGCGTGAAGGCCCTTGGCAGGTTCAACAATAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q13443	Disintegrin and metalloproteinase domain-containing protein 9 OS=Homo sapiens OX=9606 GN=ADAM9 PE=1 SV=1
A0A0B4U9L8	Zinc metalloproteinase-disintegrin-like protein F1 OS=Vipera ammodytes ammodytes OX=8705 PE=1 SV=1
Q61072	Disintegrin and metalloproteinase domain-containing protein 9 OS=Mus musculus OX=10090 GN=Adam9 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000549 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00754 all species →	F5_F8_type_C	F5/8 type C domain	Domain	Interproscan
PF00090 all species →	TSP_1	Thrombospondin type 1 domain	Domain	Interproscan
PF01562 all species →	Pep_M12B_propep	Reprolysin family propeptide	Family	Interproscan
PF08516 all species →	ADAM_CR	ADAM cysteine-rich	Family	Interproscan
PF00200 all species →	Disintegrin	Disintegrin	Domain	Interproscan
PF01421 all species →	Reprolysin	Reprolysin (M12B) family zinc metalloprotease	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000421 all species →	Domain	Coagulation factor 5/8 C-terminal domain	Interproscan
IPR001590 all species →	Domain	Peptidase M12B, ADAM/reprolysin	Interproscan
IPR008979 all species →	Homologous_superfamily	Galactose-binding-like domain superfamily	Interproscan
IPR001762 all species →	Domain	Disintegrin domain	Interproscan
IPR036383 all species →	Homologous_superfamily	Thrombospondin type-1 (TSP1) repeat superfamily	Interproscan
IPR000884 all species →	Repeat	Thrombospondin type-1 (TSP1) repeat	Interproscan
IPR036436 all species →	Homologous_superfamily	Disintegrin domain superfamily	Interproscan
IPR024079 all species →	Homologous_superfamily	Metallopeptidase, catalytic domain superfamily	Interproscan
IPR036056 all species →	Homologous_superfamily	Fibrinogen-like, C-terminal	Interproscan
IPR002870 all species →	Domain	Peptidase M12B, propeptide	Interproscan
IPR006586 all species →	Domain	ADAM, cysteine-rich domain	Interproscan
IPR014716 all species →	Homologous_superfamily	Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1	Interproscan
IPR034027 all species →	Domain	Reprolysin domain, adamalysin-type	Interproscan
IPR035992 all species →	Homologous_superfamily	Ricin B-like lectins	Interproscan
IPR000742 all species →	Domain	EGF-like domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11905 all species →	ADAM A DISINTEGRIN AND METALLOPROTEASE DOMAIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004222 all species →	Molecular Function	metalloendopeptidase activity	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0008237 all species →	Molecular Function	metallopeptidase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_031572100.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_031572100.1 across 18 RNA-seq samples of Actinia tenebrosa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

18Samples

5TPM > 0

6Conditions

6.0Max TPM

0.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole organism	5	3	0.30	1.07
Tentacle	4	0	0.00	0.00
Mesentery	3	1	2.00	6.00
Acrorhagi	3	0	0.00	0.00
whole	2	0	0.00	0.00
whole organisim	1	1	1.13	1.13

Per sample · hover a bar for the full sample record

Show the sample table (18 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR3206038	whole organism	whole organism	not recorded	not recorded	SRP070917	1.07
SRR3210696	whole organism	whole organism	not recorded	not recorded	SRP070917	0.31
SRR4696535	whole organism	Whole Organism	not recorded	not recorded	SRP092287	0.12
SRR2437124	whole organism	whole organism	not recorded	not recorded	SRP063756	0.00
SRR3193648	whole organism	whole organism	not recorded	not recorded	SRP070917	0.00
SRR4677495	Tentacle	Tentacle	not recorded	not recorded	SRP092287	0.00
SRR4677502	Tentacle	Tentacle	not recorded	not recorded	SRP092287	0.00
SRR4677522	Tentacle	Tentacle	not recorded	not recorded	SRP092287	0.00
SRR6282389	Tentacle	Tentacles	not recorded	not recorded	SRP124815	0.00
SRR4677518	Mesentery	Mesentery	not recorded	not recorded	SRP092287	6.00
SRR4677488	Mesentery	Mesentery	not recorded	not recorded	SRP092287	0.00
SRR4677492	Mesentery	Mesentery	not recorded	not recorded	SRP092287	0.00
SRR4677507	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	0.00
SRR4677512	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	0.00
SRR4677515	Acrorhagi	Acrorhagi	not recorded	not recorded	SRP092287	0.00
SRR3193284	whole	whole	not recorded	not recorded	SRP070917	0.00
SRR3216075	whole	whole	not recorded	not recorded	SRP070917	0.00
SRR3207346	whole organisim	whole organisim	not recorded	not recorded	SRP070917	1.13

Source: CnidoSite RNA-seq expression matrices (ATENE_TPM, StringTie quantification over 18 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Actinia tenebrosa tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	38	XP_031549235.1	0.997703669484039
Negatively correlated	5	XP_031558255.1	-0.648690939221279

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinia tenebrosa, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →