Gene detail

Detailed information of XP_066912798.1 in Clytia hemisphaerica

Genomic Location: NW_027103551.1:3469953...3479186
NR annotation: XP_041918586.1, slit homolog 2 protein-like [Alosa sapidissima]
Species Clytia hemisphaerica · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_066912798.1

ATGAAGTTTCTTCTAATATTATTGGTGTTTTGTTTGGTGAGTTCTACAGTACAAGAATGCCCTTTTCAATGTGAATGCGCAGACCACAAAGTCAAATGTAGCCTGTTGACGGATCAGAGTGTGGCTGGCGTTTTAAGAAGACTATCGACAAACTCGATCAAGAAATTGGATCTATCCAAAAATGTTCTAACATCTTTCAATATGGTATTACTGAAAGATTTTACCAAGTTAGAGACTTTAGTTTTGAACGAAAATAAATTGAGTTCTGTACCAAGTGGGATATCTCACCATGTACCGAGCTTGAAGAAGCTACACATCAGACATAACTCGTTGTTAAGGAATCTCACCAAACATGCTCTAGGAGGAGCCTACAATTTGGAAGTTCTGGATGTTAAAGACAGTAGCATTTCAAATCTGTTGCACGATGGTATTTTTTATAATAACTCTAAATTGACTGTATTGAATCTGGCTAGCAACAAGATTGCTGCAATGGAGAAATACGTTTTTGCTGGATTAAGGAAACTGGTGAGCCTTGATTTGAACAATAATCGTATCTCGGATTTAAGACCTGGAACTTTCAAACCGCTCAACAGTATACAACGCATCCTTATTAACTCAAACAATCTAATCCACATCCATAACCAGGTTTTCACTGGACTCAAATCAGTCAAATTGATCTCCTTAACAGGGAACCAGTTAAGAGCTCTTGGTCCTCAAGCTTTCCAAAGTCTACCGAACGTGACAACAATCTCCCTAGCTGATAACTCACTTGAATCGTTCTCCAAATCTGCATTTAAATACTCTTACATCAGCAAGGAAATCGATTTAAGAGGTAATCCTATACATTGCAGTTGCTTTATAACGTCTTTCGAACTCAGAACACTGAACTCACAAGGGAAACTAAACGGCGCCTGCCTGACGCCGCTACAATTCACCGGCCGATCATTAAAATCGATCAAGCGGAACGAGTTAGGATGCACAACGTGTGATTTTAACGAATGTAAAAACAACGCTACTTGTATCATCAAAGACGATTATTATTTCTGCCAATGCCTTAAAGGTTACCAAGGAAAATTTTGCCAGACAATCACCGAGGATGAAGATTCTACAATCCTTTGGGTTGTTATTTTGATCATTATTGTTTTGGTGGCCGTGATCTGTTCGGTGATTGGTTGGTGGTATCACCGTAAACAAAAGGGATTGTCTTTTTGTGTTATCACCAAAACACAATGTTGTTGTTGTTGTTTCATCACTGTTGTTATTCTTTGTTTACTTTTGTTCTTTATGTTACGTATTGTGTCCTACATGTACGAACACAACCTGAAGTACCATTATTCTGCGCTCAATCAAATAAGAATTCTTACAAAGATGTCTCATTTGCTATTGGGAATATTATTGACTTTGTTTTTCGTGCCCTTCGTTGAGTCATGTCCACAAGGATGTCATTGCTCCGCTATGTCAGCTAAATGTGCAAATCTACCTACACATGTGGCAATGGAAAGAACTTTATCAGAGATGCCAGAAAATATCACAAGGCTGGATCTCTCTAAAAACGGCTTAACCAGCTTCAAGGCTAGACTTTTATCAAATTTGACCAGACTAAAAGTACTTTATCTAAACGAGAACAAATTGACACAATTACCACAAAATTTATCAGTGCACGTACCAACATTACGTAAACTTTACATGAGTGATAATTACCTGTTGAAAAGTTTATCCCGCCAGTCACTTGAAACGGCTTTCAATTTGGAAAAAATTTATTTGCGTGATAGTGGTATCTTACGATTGAAAGCTGACGATTTTTACAATAATACGGCTTTATTACATTTGAACATACAGCATAACCGAATACGTAGAATTGACGTTAACGCTTTTACGGGGTTACGGCGTTTGCGGTTTTTACACCTGGATAATAATATTATACGAGAATTACCGAAACACGTATTCAACCAGTTAATCAATTTGAATAAAATGAGCGTTTCTTCGAATAGTATATCGAGTATACCAAATCACCTGTTTGCTCAAAACCGACAGTTAAAAATCATCGCTTTAAACACGAATCTAATCAACCATCTTGGGTCAGCCTCGTTTCAAGACATTGGCAATTTGACTAATATCTACTTACAAAACAATCTGATCCGGAATTTCTCCTCGGACACTTTTCAAGGTACTCATATTTCGGATAGTATCAATTTGAATGAAAACCCATTACATTGCGATTGTTATTTAACATCCTTGAAACTGAAATGGTTACGTGTAGATGGCAAAATTAAAGGTCATTGCTCTAATCCACCCGAACTGACAGGCCGCCCAATAGCATGGATCACTCGTAAAGAACTTAATTGCACTGAATGTGATTTTAACGGATGTCAAAATAACGCAACTTGCGTTATCGAAGCGGACCAATACAACTGTGTCTGCACTGCAGGCTTTGAGGGCGGACTCTGTGAAACGCCCATATCCGTCAGATTGAAAAAAGAGTCGGATTTAGGATGGATTGTGACGACAGTCGTCTGTATTTTCGTCGTTGTTCTTGGCGTCATTTTTGCAGTTTGGTATTACCGTAAACGTAAAGGGAGAGAATTATGCACGCAAAAACAGTGTTGCTGTTGCTTTTTTGCTGTGGGCGGTATTGGCGTTATTGGCGTTTTTGTTATTGTTCAATTTGTTTCGTTAATGTATGAAGAGGACTCGCACGTGTGA

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000264 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13306 all species →	LRR_5	BspA type Leucine rich repeat region (6 copies)	Repeat	Interproscan
PF13855 all species →	LRR_8	Leucine rich repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000742 all species →	Domain	EGF-like domain	Interproscan
IPR032675 all species →	Homologous_superfamily	Leucine-rich repeat domain superfamily	Interproscan
IPR001611 all species →	Repeat	Leucine-rich repeat	Interproscan
IPR050328 all species →	Family	Multifunctional Developmental and Immune Receptor	Interproscan
IPR001881 all species →	Domain	EGF-like calcium-binding domain	Interproscan
IPR026906 all species →	Repeat	BspA-type LRR region	Interproscan
IPR003591 all species →	Repeat	Leucine-rich repeat, typical subtype	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24373 all species →	SLIT RELATED LEUCINE-RICH REPEAT NEURONAL PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005615 all species →	Cellular Component	extracellular space	Interproscan
GO:0031012 all species →	Cellular Component	extracellular matrix	Interproscan
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_066912798.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_066912798.1 across 40 RNA-seq samples of Clytia hemisphaerica. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

40Samples

26TPM > 0

16Conditions

18.7Max TPM

2.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
Mature medusa	5	4	0.13	0.32
medusa · Experiment Condition A1	4	0	0.00	0.00
medusa · Experiment Condition A2	4	2	0.09	0.18
medusa · Experiment Condition A3	4	0	0.00	0.00
Early gastrula	2	2	1.28	1.32
Planula 24hpf	2	2	1.43	1.50
Planula 48hpf	2	2	0.77	0.99
Planula 72hpf	2	2	0.90	1.07
Primary polyp	2	2	12.46	14.56
Gastrozooid	2	2	17.57	18.71
Gonozooid	2	2	5.43	7.76
Stolon	2	2	7.07	8.36
Baby medusa	2	2	0.58	0.73
medusa · Experiment Condition B1	2	0	0.00	0.00
medusa · Experiment Condition B2	2	1	0.19	0.38
Mixed	1	1	1.83	1.83

Per sample · hover a bar for the full sample record

Show the sample table (40 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
ERR2816251	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	0.32
ERR2816250	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	0.21
ERR2816249	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	0.07
ERR2862245	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	0.06
ERR2816248	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	0.00
ERR3299475	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	0.00
ERR3299476	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	0.00
ERR3299477	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	0.00
ERR3299478	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	0.00
ERR3299480	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	0.18
ERR3299479	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	0.18
ERR3299481	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	0.00
ERR3299482	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	0.00
ERR3299483	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	0.00
ERR3299484	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	0.00
ERR3299485	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	0.00
ERR3299486	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	0.00
ERR2816230	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	1.32
ERR2816231	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	1.24
ERR2816233	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	1.50
ERR2816232	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	1.37
ERR2816235	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	0.99
ERR2816234	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	0.54
ERR2816236	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	1.07
ERR2816237	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	0.73
ERR2816238	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	14.56
ERR2816239	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	10.36
ERR2816240	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	18.71
ERR2816241	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	16.43
ERR2816243	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	7.76
ERR2816242	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	3.10
ERR2816244	Stolon	not recorded	Stolon	not recorded	ERP110164	8.36
ERR2816245	Stolon	not recorded	Stolon	not recorded	ERP110164	5.77
ERR2816246	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	0.73
ERR2816247	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	0.44
ERR3299471	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	0.00
ERR3299472	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	0.00
ERR3299473	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	0.38
ERR3299474	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	0.00
ERR2862244	Mixed	not recorded	Mixed	not recorded	ERP110164	1.83

Source: CnidoSite RNA-seq expression matrices (CHEMI_TPM, StringTie quantification over 40 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Clytia hemisphaerica tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	25	XP_066912699.1	0.95887671343902
Negatively correlated	6	XP_066919219.1	-0.617618401028755

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Clytia hemisphaerica, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →