Gene detail

Detailed information of XP_066913900.1 in Clytia hemisphaerica

Genomic Location: NW_027103573.1:999036...1029020
NR annotation: XP_002154548.2, coatomer subunit gamma-2 [Hydra vulgaris]
Species Clytia hemisphaerica · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_066913900.1

ATGAATATCCTGAGGAAAGACAAGAAGGATGAAGAATCAGGTATTTTCAATCCGTTTCAAGGAATAGACAAAAGCACAGTTTTGCAAGAGTCAAGAGTTTTCCATGACACCCCAATCAACACAAGAAAATGCATCCATATCTTATCCAAGGTTTTATACCTCATCAATCAGGGAACCCATATTGGAACAACAGAAGCAACAGAAACATTCTTTGCTATGACAAAACTTTTCCAATCCAAGGATGTCACCCTTCGTCGTATGTGTTATCTTGCTATCAAAGAGCTTGCCAACATTGCTGAAGATGTTATTATTGTAACCAGTAGCTTAACAAAAGACATGACCGGAAAAGATGAAGGATTTAGAGCTCCTGCCATCAGAGCTTTGTGCCGCATAACTGACTCTCAAATGTTAGCCGGTATTGAAAGATACTTGAAACAAGCCATTGTTGACAAGAACCCATCCGTTGCCAGTGCGGCCCTCGTGTCATCCCTTCATTTGTTGAAACCAAATTTTGATGTTGTGAAAAGATGGGTGAATGAAGCGCAAGAAGCTGTCAGCAGTGACAACGTTATGGTTCAGTACCATGGTCTTGGCTTATTGTACCATATCAAGCAGAATGATCGTTTGGCTGTTTCCAAATTGATCACCAAACAAGCTCGTCAATCATTACGTTCACCTTATGCATATTGTTTGTTGGTCAGAATCGCTGCCAAATACATCGATGAAGACCCTGAAAATCCTGAGAATACTCCACTGAGTGAATTCTTAGAGAGCTGTCTACGCCACAAGAGTGAGCTTGTCATCTACGAAGCTGCACGTGCCCTTGTCAACTTGAAAAGTGTGAAATCTAAAGACCTCGATCCAGCTGTTTCAGTTCTTCAACTCTTCTTGAGTTCACCACGTCCCACCTTAAGATTTGCTGCCGTTCGCACCTTGAACAAGGTGGCCATTATGCAACCACAATCAGTGATGGTTTGCAATCTGGACCTGGAAAACCTGATCACAGATGTCAATAGAAGTATTGCAACACTTGCAATCACAACTCTTTTGAAGATTGGTAATGAAAACAGTATCGATCGATTGATGAAACAAATCTCAACATTTATGTCTGAGATCTCTGATGAATTCAAGATTGTGGTGGTTGAAGCCATCAGATCACTTTGTTTGAAGTTCCCAAGGAAACACAGTGTCATGATGAATTTCTTGTCTTCTATGCTGAGAGAAGAGGGAGGCTTTGGGTACAAAAAAGCCATTGTGGACGCTGTTGTCACCATCATTGAAGATAACAATGATGCAAAAGAATCTGGACTTGCACATCTCTGTGAATTCATTGAAGATTGTGAACACACTACCCTTGCCACCAAGATCCTACATTTGTTGGGACAAGAAGGTCCAAGAACAAGCACCCCATCCAAATATATTAGGTTCATCTATAACCGTGTCATCTTGGAGAACGCTGAAGTCCGCGCGGCCGCTGTGACGTCATTGGCTAAGTTCGGAGCGCATTGTGATGCTTTATTGCCAAGCATTTTGGTGCTTTTATCAAGATGTATGATGGACACAGACGATGAAGTGAGAGACCGAGCGACTTTCTACTATCATGTATTGAGAAAAGAAGACAAACAACTAGCATCGAGCTACATTCTCAACACTTTGAGTGTATCAATCGTTGGTTTGGAGAGAGCTTTAGCTGCTTATTTGAAAGAGCCAACTGATAAACCGTTCGATATGAAGACAGTTCCCATTGCTACTGTACCTATGCATGACCAAAAAGCAGTTAAAACTAGTGGTGAATCTACGGGTGTTGCACAGAAAGCATCAACCACAAGTGTCACCACAAGACAAGACGTGTACGCCGAACAATTGGCTGCTGTTCCAGAGATTGCAGCATTAGGTCCACTCTTCAAGTCGACATCTAAACCAATTCAACTCACTGAATCGGAAACAGAGTATGTGGTGTCGTGTATCAAGCACACTTTTGCTGATCACATGGTTTTCCAGTTCAATTGTACAAATACTTTGAACGATCAGATCTTGGAGAATGTCACCGTTCAAATGGAGACTGGTGACGAAGCGGAGGTGGTCAACTACATCCCATGCCATGTCTTGAAATACGGCACTCCTTCTACAACATACACTATTGTCCAATATCCTGAGGATGCTGCCACAGTGAGTGCTTCATTTACATGCACGTTGAAGTTCATCGTGAAAGATTGTGACCCTGGGACAGGTGAACCTGATGATGACGAAGGTTATGACGACGAATACGTGCTTGAGGATGTGGAGATGGTAGTTGCAGATCATGTTCAAGGGGTTGTGCGAACCAACTTTTTGGCTTCGTGGGACGAAATTGATGATGAAAATGAAATGGAAGAAACATTCGCTCTCAGCTCAATGTCTAGCCTCGAAGAAGCAGTTACTAAAATCACTCAATTCATTGGCTTGCAACCATGCGAAAGATCTGACCGTGTACCTGAGGGAAAGAGTTCCCACACCCTCCTTCTTGCCGGTGTGTACCGTGGTGGTATTGATGTCATGGTTCGCTCACGATTAGCCCTGAAAGACGGTGTGACCATGCATTTGACTGTTCGTAGTCAAGACCCAATCGTCTCTGAAGTTGTCATGTCTGCCGTAGGCTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9PUE4	Coatomer subunit gamma-2 OS=Danio rerio OX=7955 GN=copg2 PE=2 SV=2
P53620	Coatomer subunit gamma-1 OS=Bos taurus OX=9913 GN=COPG1 PE=1 SV=1
Q9I8E6	Coatomer subunit gamma-2 OS=Takifugu rubripes OX=31033 GN=copg2 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005625 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01602 all species →	Adaptin_N	Adaptin N terminal region	Repeat	Interproscan
PF16381 all species →	Coatomer_g_Cpla	Coatomer subunit gamma-1 C-terminal appendage platform	Domain	Interproscan
PF08752 all species →	COP-gamma_platf	Coatomer gamma subunit appendage platform subdomain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR037067 all species →	Homologous_superfamily	Coatomer, gamma subunit, appendage domain superfamily	Interproscan
IPR002553 all species →	Domain	Clathrin/coatomer adaptor, adaptin-like, N-terminal	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR009028 all species →	Homologous_superfamily	Coatomer/calthrin adaptor appendage, C-terminal subdomain	Interproscan
IPR017106 all species →	Family	Coatomer gamma subunit	Interproscan
IPR032154 all species →	Domain	Coatomer subunit gamma, C-terminal	Interproscan
IPR012295 all species →	Homologous_superfamily	TBP domain superfamily	Interproscan
IPR013041 all species →	Homologous_superfamily	Clathrin adaptor, appendage, Ig-like subdomain superfamily	Interproscan
IPR013040 all species →	Domain	Coatomer, gamma subunit, appendage, Ig-like subdomain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10261 all species →	COATOMER SUBUNIT GAMMA	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005198 all species →	Molecular Function	structural molecule activity	Interproscan
GO:0006886 all species →	Biological Process	intracellular protein transport	Interproscan
GO:0016192 all species →	Biological Process	vesicle-mediated transport	Interproscan
GO:0030126 all species →	Cellular Component	COPI vesicle coat	Interproscan
GO:0030117 all species →	Cellular Component	membrane coat	Interproscan
GO:0000139 all species →	Cellular Component	Golgi membrane	Interproscan
GO:0005783 all species →	Cellular Component	endoplasmic reticulum	Interproscan
GO:0005793 all species →	Cellular Component	endoplasmic reticulum-Golgi intermediate compartment	Interproscan
GO:0006888 all species →	Biological Process	endoplasmic reticulum to Golgi vesicle-mediated transport	Interproscan
GO:0006891 all species →	Biological Process	intra-Golgi vesicle-mediated transport	Interproscan
GO:0009306 all species →	Biological Process	protein secretion	Interproscan
GO:0072384 all species →	Biological Process	organelle transport along microtubule	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17267	COPG; coatomer subunit gamma	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_066913900.1 across 40 RNA-seq samples of Clytia hemisphaerica. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

40Samples

40TPM > 0

16Conditions

233.6Max TPM

85.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
Mature medusa	5	5	79.30	88.56
medusa · Experiment Condition A1	4	4	78.51	83.34
medusa · Experiment Condition A2	4	4	85.76	88.98
medusa · Experiment Condition A3	4	4	52.00	60.49
Early gastrula	2	2	94.57	98.03
Planula 24hpf	2	2	226.43	233.63
Planula 48hpf	2	2	113.10	135.54
Planula 72hpf	2	2	80.24	91.32
Primary polyp	2	2	74.19	75.03
Gastrozooid	2	2	66.31	69.78
Gonozooid	2	2	79.86	84.42
Stolon	2	2	90.17	101.31
Baby medusa	2	2	46.92	47.00
medusa · Experiment Condition B1	2	2	80.00	81.76
medusa · Experiment Condition B2	2	2	76.70	78.20
Mixed	1	1	79.91	79.91

Per sample · hover a bar for the full sample record

Show the sample table (40 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
ERR2862245	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	88.56
ERR2816249	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	84.46
ERR2816248	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	81.84
ERR2816250	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	71.47
ERR2816251	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	70.17
ERR3299475	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	83.34
ERR3299476	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	82.54
ERR3299477	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	74.20
ERR3299478	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	73.96
ERR3299482	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	88.98
ERR3299481	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	87.70
ERR3299479	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	83.85
ERR3299480	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	82.54
ERR3299484	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	60.49
ERR3299483	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	59.60
ERR3299485	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	44.30
ERR3299486	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	43.62
ERR2816230	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	98.03
ERR2816231	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	91.12
ERR2816233	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	233.63
ERR2816232	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	219.23
ERR2816235	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	135.54
ERR2816234	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	90.66
ERR2816236	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	91.32
ERR2816237	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	69.16
ERR2816239	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	75.03
ERR2816238	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	73.35
ERR2816241	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	69.78
ERR2816240	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	62.85
ERR2816242	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	84.42
ERR2816243	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	75.29
ERR2816245	Stolon	not recorded	Stolon	not recorded	ERP110164	101.31
ERR2816244	Stolon	not recorded	Stolon	not recorded	ERP110164	79.03
ERR2816246	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	47.00
ERR2816247	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	46.85
ERR3299472	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	81.76
ERR3299471	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	78.24
ERR3299474	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	78.20
ERR3299473	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	75.20
ERR2862244	Mixed	not recorded	Mixed	not recorded	ERP110164	79.91

Source: CnidoSite RNA-seq expression matrices (CHEMI_TPM, StringTie quantification over 40 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Clytia hemisphaerica tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	31	XP_066910317.1	0.945850203931825
Negatively correlated	3	XP_066926038.1	-0.61570033072784

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Clytia hemisphaerica, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →