Gene detail

Detailed information of XP_066917179.1 in Clytia hemisphaerica

Genomic Location: NW_027103721.1:1382630...1407439
NR annotation: XP_002162597.1, DNA replication licensing factor mcm4-A-like [Hydra vulgaris]
Species Clytia hemisphaerica · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_066917179.1

ATGCCTTCTCAAGGAACACCTAAACCTTCAAAGAAAAGAAACAGGAGCACAACAAGTCCAGGATCTGAAAGATCTCGAAGATCCAGTCGACTATCCAGTAATTTATCAGAAGATCAACCCTCTGATCCTGTTGAAGCTCCAACAAAACAACGAAAAACCGAAGATAAGCCATCATCACCACTTCCCTTGGCTCCTACCTCTCCAAATGTATCACAAAATGAACATGACAGATCTGGGGATCATGACAGGTCCTTACTAAGTCGCACTGGTTTATTAAATACAAGTGAAATTGATTTAAGCTCTCCCTTGAATTATGGAACACCAGCTTCCTCAAGGCTTGGATCCATGGCAGTGGGAACACCACGAGGCACACCCGTCAGGCTGAGAAGTGATATTCAAAGTACCAGAAAATTGAAACAAGTCAATGTAGGAGGTGGCAGTGAACCTACTGACAATAATGACCCCGTTGTATCAAGTGAAGCTCCTGCAGAACCAAAACTTGTCATTTGGGGTACAGACGTTGTGGTTTCAGAAACCAAGGAACGTTTCAGACAGTTCATTTTGAACTTCAAAGATGACACAGTTGAAGAATATGATCCTGCCCAAGCCCTTTACATGCAGAAATTAGATGAGATCTCCATCACAGAAAAACCATTTTTCAATGTAGATTGTTTACATTTGAAAGCATATCATGCTGAATTATACCGCCAACTTGTCTGCTATCCACAAGAAGTGATCCCAACCTTTGACATGGCTGTCAATGAAGTCTTCAATGAAAATCATGAAAACATTGAACTAGAACACCAAATCCAAGTTCGAACTTTCAATGTTGACAAAACTATGAATATGCGATCACTTAACCCTGAAGATATTGACCAAATGATAACCATCAGTGGAATGATCATCCGAACTTCAAACATCATCCCTGAAATGAGAGAATCATTCTTCCAATGTCACGTTTGTCGTGCAACGCGAACCGTTGAAATTGACCGTGGTACCATCAACGAACCTACTTCATGTGCCAACTGTAACACTCAACAAAGTATGATGTTGGTTCACAACAGATCTCAATTCACGGACAAACAAATGATCAAGATGCAGGAATCACCTGATGACATGCCAGCCGGTCAAACGCCTCACACTGTCATCATGTACGGTTATGGTGATCTTGTGGATAGTGTTCAACCTGGAGACAGAGTAACAGTGACTGGTATTTATCGCGCGACACCGCTTCGCGTGAACCCAAGGATGAGAAATGTGAAATCTGTATACAAGACGTATATAGATGTCATTCACTTCAGAAAAACTGATAAGAAGAAGCTGCATGAACGTGATGCTGACAGTCAAGTCGCTTTCACCCCTGAACGTGTTGACTATTTGAAAGAATTGTCCGCCATGCCTGATATCTATGAAAGATTAGCTCGAGCTCTAGCACCAAGTATTTACGAGAATATTGACATCAAGAAAGGAATTTTGCTTCAACTGTTCGGAGGAACTTTCAAAGATTTCACTGCTGCTGGCCGTGGAAAATTCAGATCTGACATCAACATCCTTCTTTGTGGAGATCCTGGTACCAGTAAATCGCAATTGCTTCAATACGTGCACAACTTGGTACCTCGTGGTCAATACACATCTGGTAAAGGATCATCAGCTGTTGGTCTTACTGCTTATGTCACCAGAGATCCGGAAACCAACCAACTGGTACTGCAAACGGGTGCTTTGGTATTGAGTGACAATGGTATTTGTTGCATCGACGAGTTCGATAAGATGAGCGAAGGAACGCGCTCAGTTCTTCATGAAGTTATGGAACAACAAACTCTTTCTATCGCTAAAGCAGGCATCATTTGTCAACTGAACGCCCGCACGTCTATCTTGGCGGCCGCCAACCCACAGAAATCCCAATGGGATCCTAACCTTACAACTGTGGAAAACATTCAACTTCCTCACACCCTCTTGTCAAGATTCGATTTGATTTTCTTGATCCTCGATCCACAAGACGAGCATTTTGATCGTCGCCTAGCAACACATCTTGTCTCGCTGTACCATATGTCTGAACAAGAGGCGGACGAGGAAGATGTGGATATGTCCACACTTCGAGATTACCTTGCGTACGCCAAAAACAATGTTTCACCAAAACTCAATGATGAAGCATCTCAAACTCTCATCAGCTCTTACGTTGAAATGAGGAAAGCCGGCAGTAACAGAGGTGCGGTGTCAGCGTATCCAAGACAACTGGAAGCTTTGATTCGATTGGCTGAAGCACACGCACGAATGAGGTTTTCAAATGTGGTAGACATCGTAGATGTGGAAGAAGCCAAGCGACTTCAGCGGGAGGCTTTGAAACAGTCTGCAATGGACCCCAAGACTGGCATGATCGATATCAACATCCTGACCACAGGACTCAGTATCACCGACCGCAAACGACGTTCTGACGCCGCCAAGGCCCTTCTCGAATTAATGAAAGGGAAAGGAAAGATTGCCACTTTGAACTATTACAAACTTTTCGAAGAATTTAGAGAACAAGCTGAAGCAAAAATCAGTCGAACGTTATTCGATGACGCGTTGAAAATTTTACAAGACGATGATCAAATTATGATGGGTGAAGATAAAAAGACCATCAAAATGATGGCTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P30664	DNA replication licensing factor mcm4-B OS=Xenopus laevis OX=8355 GN=mcm4-b PE=1 SV=3
Q6GL41	DNA replication licensing factor mcm4 OS=Xenopus tropicalis OX=8364 GN=mcm4 PE=2 SV=1
Q5XK83	DNA replication licensing factor mcm4-A OS=Xenopus laevis OX=8355 GN=mcm4-a PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005868 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17855 all species →	MCM_lid	MCM AAA-lid domain	Domain	Interproscan
PF00493 all species →	MCM	MCM P-loop domain	Domain	Interproscan
PF17207 all species →	MCM_OB	MCM OB domain	Domain	Interproscan
PF14551 all species →	MCM_N	MCM N-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001208 all species →	Domain	MCM domain	Interproscan
IPR008047 all species →	Family	Mini-chromosome maintenance complex protein 4	Interproscan
IPR041562 all species →	Domain	MCM, AAA-lid domain	Interproscan
IPR031327 all species →	Family	Mini-chromosome maintenance protein	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan
IPR018525 all species →	Conserved_site	Mini-chromosome maintenance, conserved site	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR033762 all species →	Domain	MCM OB domain	Interproscan
IPR027925 all species →	Domain	MCM, N-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11630 all species →	DNA REPLICATION LICENSING FACTOR MCM FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0032508 all species →	Biological Process	DNA duplex unwinding	Interproscan
GO:0003678 all species →	Molecular Function	DNA helicase activity	Interproscan
GO:0006270 all species →	Biological Process	DNA replication initiation	Interproscan
GO:0042555 all species →	Cellular Component	MCM complex	Interproscan
GO:0006260 all species →	Biological Process	DNA replication	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0000727 all species →	Biological Process	double-strand break repair via break-induced replication	Interproscan
GO:0003697 all species →	Molecular Function	single-stranded DNA binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006268 all species →	Biological Process	DNA unwinding involved in DNA replication	Interproscan
GO:0006271 all species →	Biological Process	DNA strand elongation involved in DNA replication	Interproscan
GO:0017116 all species →	Molecular Function	single-stranded DNA helicase activity	Interproscan
GO:1902975 all species →	Biological Process	mitotic DNA replication initiation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K02212	MCM4, CDC54; DNA replication licensing factor MCM4	EC:5.6.2.3	DNA replication proteins	ko03032	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_066917179.1 across 40 RNA-seq samples of Clytia hemisphaerica. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

40Samples

39TPM > 0

16Conditions

65.0Max TPM

31.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
Mature medusa	5	5	54.24	61.97
medusa · Experiment Condition A1	4	4	19.89	21.72
medusa · Experiment Condition A2	4	4	17.82	18.30
medusa · Experiment Condition A3	4	3	3.57	5.90
Early gastrula	2	2	64.94	65.04
Planula 24hpf	2	2	58.87	61.11
Planula 48hpf	2	2	51.61	60.08
Planula 72hpf	2	2	34.65	39.93
Primary polyp	2	2	19.41	20.35
Gastrozooid	2	2	9.03	9.93
Gonozooid	2	2	50.87	58.03
Stolon	2	2	26.15	28.86
Baby medusa	2	2	27.81	28.59
medusa · Experiment Condition B1	2	2	12.90	13.14
medusa · Experiment Condition B2	2	2	30.49	30.55
Mixed	1	1	58.61	58.61

Per sample · hover a bar for the full sample record

Show the sample table (40 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
ERR2816248	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	61.97
ERR2816249	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	58.61
ERR2816250	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	57.14
ERR2816251	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	56.14
ERR2862245	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	37.36
ERR3299475	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	21.72
ERR3299476	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	20.87
ERR3299478	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	18.53
ERR3299477	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	18.45
ERR3299481	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	18.30
ERR3299482	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	18.05
ERR3299480	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	17.78
ERR3299479	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	17.14
ERR3299486	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	5.90
ERR3299484	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	4.25
ERR3299483	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	4.13
ERR3299485	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	0.00
ERR2816230	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	65.04
ERR2816231	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	64.84
ERR2816233	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	61.11
ERR2816232	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	56.63
ERR2816235	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	60.08
ERR2816234	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	43.13
ERR2816236	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	39.93
ERR2816237	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	29.38
ERR2816238	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	20.35
ERR2816239	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	18.48
ERR2816241	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	9.93
ERR2816240	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	8.13
ERR2816242	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	58.03
ERR2816243	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	43.70
ERR2816245	Stolon	not recorded	Stolon	not recorded	ERP110164	28.86
ERR2816244	Stolon	not recorded	Stolon	not recorded	ERP110164	23.45
ERR2816247	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	28.59
ERR2816246	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	27.03
ERR3299472	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	13.14
ERR3299471	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	12.66
ERR3299474	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	30.55
ERR3299473	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	30.42
ERR2862244	Mixed	not recorded	Mixed	not recorded	ERP110164	58.61

Source: CnidoSite RNA-seq expression matrices (CHEMI_TPM, StringTie quantification over 40 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Clytia hemisphaerica tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	33	XP_066913318.1	0.960897462435754
Negatively correlated	12	XP_066928302.1	-0.833158253103322

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Clytia hemisphaerica, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →