Gene detail

Detailed information of XP_066917916.1 in Clytia hemisphaerica

Genomic Location: NW_027103741.1:653466...658869
NR annotation: XP_047145768.1, lysosomal alpha-mannosidase-like [Hydra vulgaris]
Species Clytia hemisphaerica · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_066917916.1

ATGGCTTGGAATATTGCATTTATTTTATTTCTATGCTGTGTGCATAGCACGTTATCGTTCGATTGTAGCTCGAAAGAAGAGAAACTACAAGTACATTTAGTGCCCCATACACACGATGATGTTGGATGGTTGAAAACAGTGGATGAGTATTTCTATGGTGCAAATAAAACCATACAAGATGCCGCAGTGCAATATATTTTGGATACTGTTGTGACAGAATTACAGAAGAACCCAAATCGAACTTTTATTTACGTGGAGATTGCATTCTTCAAGAGATGGTGGGACCAACAGACAGATTATATGAAGAAGGTTGTGAAGAAATTGGTGGCCGATCGCCAATTAGAATTCATTAATGGTGGATGGTGCATGAACGATGAAGCTGCCACTCATTACAATGCTATCATCGATCAAATGACATTGGGTCATCTCTTCATCAACGACACATTCGGTGAAGAAGCCCGTCCGACGATCGGTTGGCACATCGATCCTTTCGGACACTCTGCAGAACAAGCTTCATTGTTCTCACTGATGTCTTTCGATGGTTTCTTCTTTGGTAGGATTGACCAAGAAGATAAGGACAAACGTTTGAAGGAACAACGAATGGAAATGATTTGGCGTGGAAGTCGAAACTATGGGAAAGATTCTCAAATCTTCACTGGTGTGACGTATAATGGTTATGGGCCTCCAGCTGGCTTTTGTTTTGATGACTATTGCGCTGACCCTCCAATTCAAGATGACCCAAGATTGTATGACAACAATGTGAAAGAGAGAGTAGACCTGTTCGTGCAAGAGACTTGCGATCAAGCCAAAAGTTACAAGACCAATCACATTATGTTAACAATGGGATCAGATTTCCAATACCAAAATGCTTTGAAGTGGTTCAAAAATCTTGACAAACTTATCAAATACGTTAATAGGGATGGAAGAGTGAACGTTTTCTACTCCAGTCCATCACGTTACTTGAAAGCACTCCATAATGCAAAGAAAGTTTGGGAGGTCAAAACAGACGATTTCTTTCCCTATGCACACTGTCCGCATTGTTACTGGACCGGATATTTTACCAGCCGTCCCGCATTGAAAGCTTATATCCGGGAATCCAATGGAATGCTCCAAGCATGTAAACAAATGGAGACTTTGAACTTTGGTGATCCAAGGGTAGACACGCCCTCTTCAGACGGTTTGAGGCGTGCTATGGGTGTCAACCAACATCACGATGCAGTAACAGGGACAGAGAAACAACACGTTGCATTTGATTACGCCAAACGTCTATCCATTGCACGGGAAGAATGCAAGGACTTGATGAGCTCGTTCGTCGAATCAAAAATGGCTTCCAAAGATGTCAAATTCCAATATTGTGACTTTTTGAACATCAGTATGTGCGAAATCACCGAGACCGAGAAATCAGTTGTACTTAATGTCTACAATCCTATTGGTAGATCCATTTCTTCTTATGTTCGTATACCGGTCAATTCACAATCGTACACCGTCAAAGGATCGGATGGAAAAGTGATCGATTCTCAAGTCGAAAGTACTACGGCTGAAACAATGAAGTTACGACGCGCCAATTCTGGTTACGCGGCTTACGAGTTGATTTTCGAGGTTTGCGCTCCTGCCGTTGGATTCTCCACTTACTTCATTACGAAGAATGAGGAGAAAAAGCGTGAAAAGAGACACGTTATTAACAAGAAAAATGCTGAAGATGATTACTTCATAGAGAACGAGCATTTAAGGTTAGAATTCTCAAAAGACACTGGCCGTCTCACTCGAATGATTCGAAAAGATGCGGATCTTTCTTTAGCCGTTGATCAACAATTCTTTTGGTATAATGGTAGTCAAGGTAACGATGTTAGTTGTCAGACCTCAGGTGCGTACATCTTCCGACCCAATCGTAGTGAACCTTACCCAATGACTAATGGAAATAAAGCAACCATGATTATGGTCAAAGGAGGGTTGGTTCAAGAAGTTCGACAATCGTTTGGTCCTATCGTCAGCCAAGTGATTCGTCTATACAAAGGGCAGCCTTATGCTGAATTTGAGTACACTGTGGGACCGATTCCTATCAGCGATCACCTCGGTAAAGAAATCATTACAAGATTCGATACGGAGATTGAAAATGGCGGGAAGTTTTACACCGATGCGAACGGACGAGAAATGAAAGAGCGGATCAGAAACCACCGTGATACATGGAAACTGAATGTGTCCGAACCGGTGTCCGGAAATTATTACCCAATCAACAGTCGTATTTTTATCAACGATACAAAGTTGCAGTTGACAGTGTTGAATGATCGATCGCAGGGAGGAAGTAGCATCAATGACGGTCAACTTGAAATCATGCTTCATCGTCGGTTGCTCAAAGATGACTTCCTTGGTGTAGGCGAGCCCTTAAACGAACCAGGTGTCAATGGTAATGGTCTAGTCACACGTGGTAAACATCGTGTTTTGCTAACCACACCCGAGGAAGCGAACAAATTGCATCGGATTCAGGGAGAACTTATGATGCTTCAACCTATTTTGAGCTTTGCGAAGAACGCTCACTCCACAAAATATTGGAGAAACTTTATGACACCCGAGTACAGTGCTCTCTCAAAGGCTCTTCCAGTGGATGTACATTTGCTCACCATGGAAACCATTCGGCAAAATACCGTACTGATGAGATTCGAAAATTACGTAGAGGCGTACGAGGGCGGAGAGGAGATTGAAATCGATTTAGACGGTTTGTTTAAAGAATTTTCCGTGGTTTCACTTACCGAAATGAATCTTTCAGCCAGTCAAAAGTTGAAGGATAAACAAATGTGGGACTGGAATACTAACGAAACACAATTTCATTTGCACCGTGATGAGAGTTTTATCAAATTTAAAAGTGCCATGAAAATCTCACTCAAACCAATGCAAATCAAAACATTTATTGTGGAAATCAAAAAGAACTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q29451	Lysosomal alpha-mannosidase OS=Bos taurus OX=9913 GN=MAN2B1 PE=1 SV=4
Q60HE9	Lysosomal alpha-mannosidase OS=Macaca fascicularis OX=9541 GN=MAN2B1 PE=2 SV=1
Q8VHC8	Lysosomal alpha-mannosidase OS=Cavia porcellus OX=10141 GN=MAN2B1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001985 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF09261 all species →	Alpha-mann_mid	Alpha mannosidase middle domain	Domain	Interproscan
PF07748 all species →	Glyco_hydro_38C	Glycosyl hydrolases family 38 C-terminal domain	Domain	Interproscan
PF01074 all species →	Glyco_hydro_38N	Glycosyl hydrolases family 38 N-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR037094 all species →	Homologous_superfamily	Glycoside hydrolase family 38, central domain superfamily	Interproscan
IPR013780 all species →	Homologous_superfamily	Glycosyl hydrolase, all-beta	Interproscan
IPR015341 all species →	Domain	Glycoside hydrolase family 38, central domain	Interproscan
IPR027291 all species →	Homologous_superfamily	Glycoside hydrolase 38, N-terminal domain superfamily	Interproscan
IPR028995 all species →	Homologous_superfamily	Glycoside hydrolase families 57/38, central domain superfamily	Interproscan
IPR011330 all species →	Homologous_superfamily	Glycoside hydrolase/deacetylase, beta/alpha-barrel	Interproscan
IPR011682 all species →	Domain	Glycosyl hydrolase family 38, C-terminal	Interproscan
IPR011013 all species →	Homologous_superfamily	Galactose mutarotase-like domain superfamily	Interproscan
IPR000602 all species →	Domain	Glycoside hydrolase family 38, N-terminal domain	Interproscan
IPR050843 all species →	Family	Glycosyl Hydrolase Family 38	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11607 all species →	ALPHA-MANNOSIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004559 all species →	Molecular Function	alpha-mannosidase activity	Interproscan
GO:0006013 all species →	Biological Process	mannose metabolic process	Interproscan
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan
GO:0030246 all species →	Molecular Function	carbohydrate binding	Interproscan
GO:0005764 all species →	Cellular Component	lysosome	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12311	MAN2B1, LAMAN; lysosomal alpha-mannosidase	EC:3.2.1.24	Lysosome	ko04142	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_066917916.1 across 40 RNA-seq samples of Clytia hemisphaerica. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

40Samples

40TPM > 0

16Conditions

126.9Max TPM

48.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
Mature medusa	5	5	40.72	50.26
medusa · Experiment Condition A1	4	4	31.37	33.82
medusa · Experiment Condition A2	4	4	26.48	30.99
medusa · Experiment Condition A3	4	4	24.01	25.07
Early gastrula	2	2	47.26	50.98
Planula 24hpf	2	2	112.28	116.55
Planula 48hpf	2	2	113.83	116.82
Planula 72hpf	2	2	100.87	118.95
Primary polyp	2	2	26.88	27.03
Gastrozooid	2	2	48.97	54.82
Gonozooid	2	2	44.87	49.89
Stolon	2	2	100.90	126.88
Baby medusa	2	2	29.31	29.56
medusa · Experiment Condition B1	2	2	25.93	25.98
medusa · Experiment Condition B2	2	2	27.60	29.28
Mixed	1	1	52.40	52.40

Per sample · hover a bar for the full sample record

Show the sample table (40 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
ERR2816250	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	50.26
ERR2862245	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	43.85
ERR2816251	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	41.59
ERR2816249	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	34.02
ERR2816248	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	33.88
ERR3299475	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	33.82
ERR3299476	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	33.16
ERR3299477	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	29.41
ERR3299478	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	29.09
ERR3299479	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	30.99
ERR3299480	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	30.87
ERR3299482	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	22.89
ERR3299481	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	21.16
ERR3299484	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	25.07
ERR3299483	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	24.89
ERR3299486	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	23.32
ERR3299485	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	22.78
ERR2816230	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	50.98
ERR2816231	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	43.54
ERR2816233	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	116.55
ERR2816232	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	108.01
ERR2816235	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	116.82
ERR2816234	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	110.84
ERR2816236	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	118.95
ERR2816237	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	82.79
ERR2816239	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	27.03
ERR2816238	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	26.74
ERR2816240	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	54.82
ERR2816241	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	43.11
ERR2816242	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	49.89
ERR2816243	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	39.84
ERR2816245	Stolon	not recorded	Stolon	not recorded	ERP110164	126.88
ERR2816244	Stolon	not recorded	Stolon	not recorded	ERP110164	74.92
ERR2816247	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	29.56
ERR2816246	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	29.06
ERR3299472	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	25.98
ERR3299471	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	25.89
ERR3299473	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	29.28
ERR3299474	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	25.93
ERR2862244	Mixed	not recorded	Mixed	not recorded	ERP110164	52.40

Source: CnidoSite RNA-seq expression matrices (CHEMI_TPM, StringTie quantification over 40 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Clytia hemisphaerica tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	23	XP_066918058.1	0.90885721443131
Negatively correlated	4	XP_066915465.1	-0.75772621732934

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Clytia hemisphaerica, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →