Gene detail

Detailed information of XP_066918817.1 in Clytia hemisphaerica

Genomic Location: NW_027103774.1:786375...801762
NR annotation: XP_012554042.1, serine/threonine-protein kinase mTOR [Hydra vulgaris]
Species Clytia hemisphaerica · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_066918817.1

ATGAGTATCAACAATAAACTACAGAATCCTGAAGCGGCTAATGGTGTTCTGATGTATGCCAAGAGAAACTCCAAGGTCGATTATAAAGTGCAACAAAGATGGTACGAGAAACTTCACGAATGGGAGAACGCATTGAATGCTTACGATAAGAAACATGCAACACACCCTGACGATCATGAAATCTTGTTAGGCCGTATGCGGTGTTTGGAAGCGCTCGGAAAATGGGGTGAATTACACAATTTGGCTTGTGAGAAATGGTCAGCGGTAAGCGATGATGTTCGACATAAAATGGCAAGAACTGCTGCTTCCGCTGCTTGGGGTCTGGATACTTTCGAAGGAGCTTTCTTCAGAGCTGTCTTACAAATCCATAAAAATCAATTCGTCAGAGCACAAAGTTGTATCGATAATGCTCGAGACATGTTGGATACTGAATTGACGGCTATGGTCGGAGAATCCTACAACAGAGCTTACAATGCTATGGTGAACGTACAAATGTTGTCAGAACTCGAAGAAGTTATTCAATACAAGCTGGTTTCTGAGCGCCGCAAAGCCATCAAATCGGCCTGGTGGAACCGGTTACAAGGTTGTCAAGCCAACGTGGAGGAGTGGCACCGTATCCTGCAAGTGCACTCGCTGGTCTTGACTCCACAAGAAGACATGAAAACTTGGCTCAAATATGCAAGCTTGTGCAGAAAGTCTGGCCAATTGGGTTTATCTCAACAAACCCTTGTGACATTGCTGGAAGCGGATCCGTATTTGAACCAAGACAAACCCATCCCGTCGACGTACCCTATGGTCACTTTCGCTTTTATGAAGCACATGTGGAAATCTGGACAACGTCAAGAGGCTTTCAAACACCTGCAATACTTTGTTCGAACCACTCTCCTTCCACAAGTGTTACCACTTGGTGATCTTGATGATGAATCTGAAAAGAAGAGAAACGAAACCATCAGCCTTCTTGCTAAATGTCACATGAAACTTGGCGAATGGATGACAATAACAGAAGGGGTCAAAGGGGTCAATTCGAATACCATCCCACATATATTGCAATATCATGCCACCGCAACCAAATACGCTGACAAAAGTTACAAGGCGTGGCATTCGTGGGCTTTGATGAATTATGAGAGTGTTTTGTATTACAAAAACAGTGATACACCCATTGCACCTCCTACACCAGCCGTTTCCAGTCCTCCTGGATCACCAAGAAAACCTCAGCCGTTGGATGCGACGGTGCATAATTATACAGTACCTGCTGTCAAAGGTTTCTTCCATTCCATTTCCTTGTCACGTGGTAATTCGCTCCAAGACACTCTGAGATTGTTGACGTTGTGGTTCGATTTTGGACATTACGATGACGTGCACAAAGCACTTGTGGATGGATTAAAAACCATTCATATTGATAACTGGCTTCAGGTGATCCCGCAGTTGATAGCGCGTATCGATACACCACGACAAATGGTTGGTCGACTGATCCATCAACTCTTATCCGACGTCGGAAAGCAACATCCTCAGGGTTTGATCTACCCGTTAACCGTCGCTTCGAAGTCAGCCAGTGCTGATCGCCGAAACGCTGCCGAACAAATCCTCTGTAATCTACGCGAGCACAGTCTAGCGTTGGTAGAACAGGCTATGATGGTAAGCGAAGAGTTGATCCGAGTTGCTATTCTGTGGCATGAATTATGGGCTGAAGGACTGGAAGAAGAAGCATCTCGGTTATATTTTGGTGAACGTAACGTGAAAGGAATGTTTGCCGTGTTGGACCCTTTACATCAGATCATGGAGAATGGCCCTCAAACACTCAATGAAATATCTTTCCAACAGGCGTACGGTCGTGATTTGATGGAAGCAAGAGATTGGTGTCGTAAATACCAGAACACGAAGAATGATAAAGATTTGACGCAAGCCTGGGATTTGTATTATCACGTCTTCAGAAGAATCTCTAAACAACTACCTCAGCTAACATCTATCGAATTGCAATATGCTTCACCGAAACTGTTGGAATGTAAAGACCTGGAACTAGCTGTCCCTGGTACTTACGAACCTGGCAAACCCATCACAAAAATCAAAACTATCAGTACTACTCTCAATGTCATCACTTCAAAACAAAGACCAAGAAAGTTGAGCATTACTGGAAGCAACGGTGCAGAATTCATGTTCTTACTGAAAGGCCACGAAGATTTGCGACAAGACGAACGTGTCATGCAACTCTTTGGTCTTGTCAATACACTGTTAGCCAACGACTCGGTTACTTTCAAACGACATTTAAGTATTCAACGTTACCCGGTTATTCCGCTATCAACAAACTCGGGATTAATCGGATGGGTACCACATTCCGATACTTTGCACACTCTTATTCGAGACTATCGTGAAAAGAAGAAGATTATGTTGAACATCGAACATCGAATCATGTTAAAAATGACGCCCGACTATGAACATTTGACGCTGATTCAAAAAGTGGAGGTTTTCGAACATGCTTTGAACACAACACAGGGTGACGATTTAGCGAAAGTACTCTGGCTGAAGAGTCCAAGCTCTGAGGTTTGGTATGACCGCCGTTTAAATTACACGCGGTCGCTCGCTGTGATGTCAATGGTGGGTTACGTTCTTGGATTAGGTGACAGGCATCCTTCGAATTTGATGTTGGATCGAATGTCTGGAAAGATTTTACATATCGATTTCGGTGATTGCTTCGAAGTTGCAATGACGAGAGAAAAGTTTCCCGAGAAAATCCCATTCCGCTTGACCAGAATGCTGACGAACGCTATGGAGGTGACGGGTATTGACGGCAACTATCGTATGACGTGTGAAAGTGTCATGCGTGTTTTACGTGAAAACAAAGACAGTTTGATGGCCGTACTCGAAGCTTTCGTTTACGATCCTTTATTGAAATGGCGCTTGATTGATACGGAGAAACGATCAAAAGGAAGACAAGAATCTTATTCAACGCACAATGAAGGTCACGAATTCCAAGATAACGTGGATCGAACGCACGACCGTCCACGTGGTAAAAAGGTCACCAATCCGGAACACCCGACACAAGATCCGGAACACAGTAATAATAAACCGGAAGCCGTCAATAAGAGAGCGTTACAAATCGTGAACCGTGTCCGTGACAAATTGACGGGGCGCGATTTCAACAAAGACGAAGCGATAGATGTTGACACACAAGTTGATTTATTGATTCAACAAGCCACTTCACATGCTAACCTCTGTCAAGCTTATATTGGATGGTGCCCGTTCTGGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9JLN9	Serine/threonine-protein kinase mTOR OS=Mus musculus OX=10090 GN=Mtor PE=1 SV=2
P42345	Serine/threonine-protein kinase mTOR OS=Homo sapiens OX=9606 GN=MTOR PE=1 SV=1
P42346	Serine/threonine-protein kinase mTOR OS=Rattus norvegicus OX=10116 GN=Mtor PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003065 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02259 all species →	FAT	FAT domain	Repeat	Interproscan
PF02260 all species →	FATC	FATC domain	Family	Interproscan
PF00454 all species →	PI3_PI4_kinase	Phosphatidylinositol 3- and 4-kinase	Family	Interproscan
PF08771 all species →	FRB_dom	FKBP12-rapamycin binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036738 all species →	Homologous_superfamily	FKBP12-rapamycin binding domain superfamily	Interproscan
IPR014009 all species →	Domain	PIK-related kinase	Interproscan
IPR003151 all species →	Domain	PIK-related kinase, FAT	Interproscan
IPR003152 all species →	Domain	FATC domain	Interproscan
IPR018936 all species →	Conserved_site	Phosphatidylinositol 3/4-kinase, conserved site	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR000403 all species →	Domain	Phosphatidylinositol 3-/4-kinase, catalytic domain	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR026683 all species →	Domain	Serine/threonine-protein kinase TOR, catalytic domain	Interproscan
IPR009076 all species →	Domain	FKBP12-rapamycin binding domain	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan
IPR036940 all species →	Homologous_superfamily	Phosphatidylinositol 3-/4-kinase, catalytic domain superfamily	Interproscan
IPR050517 all species →	Family	DNA Damage Response and Repair Kinase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11139 all species →	ATAXIA TELANGIECTASIA MUTATED ATM -RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0044877 all species →	Molecular Function	protein-containing complex binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0016301 all species →	Molecular Function	kinase activity	Interproscan
GO:0004674 all species →	Molecular Function	protein serine/threonine kinase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0016242 all species →	Biological Process	negative regulation of macroautophagy	Interproscan
GO:0031929 all species →	Biological Process	TOR signaling	Interproscan
GO:0031931 all species →	Cellular Component	TORC1 complex	Interproscan
GO:0031932 all species →	Cellular Component	TORC2 complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_066918817.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_066918817.1 across 40 RNA-seq samples of Clytia hemisphaerica. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

40Samples

40TPM > 0

16Conditions

9.8Max TPM

5.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
Mature medusa	5	5	5.29	8.00
medusa · Experiment Condition A1	4	4	5.90	6.58
medusa · Experiment Condition A2	4	4	6.71	7.39
medusa · Experiment Condition A3	4	4	7.61	9.76
Early gastrula	2	2	6.06	6.26
Planula 24hpf	2	2	5.71	6.03
Planula 48hpf	2	2	5.21	5.62
Planula 72hpf	2	2	4.82	4.92
Primary polyp	2	2	4.19	4.25
Gastrozooid	2	2	3.28	3.45
Gonozooid	2	2	3.66	3.94
Stolon	2	2	3.23	3.34
Baby medusa	2	2	5.10	5.40
medusa · Experiment Condition B1	2	2	7.22	7.72
medusa · Experiment Condition B2	2	2	4.81	5.18
Mixed	1	1	2.32	2.32

Per sample · hover a bar for the full sample record

Show the sample table (40 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
ERR2816250	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	8.00
ERR2816251	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	7.49
ERR2816249	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	4.96
ERR2816248	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	4.26
ERR2862245	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	1.75
ERR3299477	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	6.58
ERR3299475	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	6.25
ERR3299476	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	5.84
ERR3299478	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	4.95
ERR3299481	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	7.39
ERR3299482	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	6.80
ERR3299480	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	6.59
ERR3299479	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	6.05
ERR3299485	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	9.76
ERR3299486	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	7.04
ERR3299484	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	6.83
ERR3299483	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	6.79
ERR2816230	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	6.26
ERR2816231	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	5.85
ERR2816233	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	6.03
ERR2816232	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	5.40
ERR2816235	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	5.62
ERR2816234	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	4.80
ERR2816236	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	4.92
ERR2816237	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	4.72
ERR2816238	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	4.25
ERR2816239	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	4.14
ERR2816241	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	3.45
ERR2816240	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	3.11
ERR2816242	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	3.94
ERR2816243	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	3.38
ERR2816245	Stolon	not recorded	Stolon	not recorded	ERP110164	3.34
ERR2816244	Stolon	not recorded	Stolon	not recorded	ERP110164	3.12
ERR2816246	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	5.40
ERR2816247	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	4.80
ERR3299471	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	7.72
ERR3299472	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	6.73
ERR3299473	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	5.18
ERR3299474	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	4.44
ERR2862244	Mixed	not recorded	Mixed	not recorded	ERP110164	2.32

Source: CnidoSite RNA-seq expression matrices (CHEMI_TPM, StringTie quantification over 40 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Clytia hemisphaerica tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	7	XP_066929547.1	0.820857201526432
Negatively correlated	71	XP_066922700.1	-0.760857631756943

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Clytia hemisphaerica, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →