Gene detail

Detailed information of XP_066919835.1 in Clytia hemisphaerica

Genomic Location: NW_027103286.1:2709873...2734820
NR annotation: XP_047125803.1, ubiquitin-like modifier-activating enzyme 1 [Hydra vulgaris]
Species Clytia hemisphaerica · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_066919835.1

ATGTCAACATCGAACCAAGAATCGCCAAGCAGCTCGCCACCTAGCAAACGTGCAAAGATTTCTCATCATCAGAACGGTGCAGCCTCTAAACACGAACAAATAGAAGCCATGGAGACTGAAACCAATGGAACATCCCATGAAATTGATGAGGGGCTTTACTCTCGACAACTTTACGTATTGGGACATGAGGCTATGAAAAAAATGGGACTTTCCAATGTCTTTATCTCTGGCATGAAAGGCTTAGGTGTTGAAGTTGCTAAAAATATCATCCTTGCTGGAGTCAAGTCAGTAACTATTCATGATCCAGAGCAATGTTCTATTGAAGATTTGAGTTCACAGTACTATCTATCTGAGAAAGACATTGGTAAAAACAGAGCCCAAGTTTCTGTGGAAAATCTTTCTGAGCTCAACACTTATGTTCCTGTGACTGTCCACGAGGGAGAGCTCACTGATAATTTCTTGACAAAGTTTCAAGTGGTTGTATTGACAAATTCTTCACTCGATGAACAGCTAAGAATTAGTGATTTGACTCACAAAAATAATCAGAAGCTTATTGTTGTTGATACTAAAGGATTGTTCGGACAACTTTTCTGTGATTTTGGAGAAAAATTTGCCGTCATGGATACAAATGGTGAACAACCCATCAGCAACATGATCGCTTCAGTCACAAAAGATAAAGAAAGTATTGTGACATGCTTAGATGAAACACGTCATGGACTTGAGGATGGTGATCATGTCACATTTACAGAAGTCCAAGGAATGACTGAATTGAATGGATGTGAGCCAAGAAAGATTAAAGTTTTGGGACCATACACTTTCAGCATTGGAGACACCTCTGGGCTTTCAGATTATGTTAGAGGTGGCATAGTCTCTCAAGTAAAAGTACCAAAAGTTGTTGAATTTAAATCTTTCCGAGACTCATTAGCTGAACCAGAGCAATTGATCACAGATTTTGCCAAATTTGAGAGACCATCACAACTCCATCTTGGTTTCCAAGCTTTACACGAATACAAAAAAGTTACAGGACTTTTACCAAGACCAAAAAATAAGGTTGATGGTGATAAATTTATTGATATTGCTAAAGACTTGAACTCAAAAGCCCAAAGCAAAGTTGATGAATTAGATGAGAAGCTACTGCGGGAACTTGCATCACAAGCCACTGGAGATGTATGTCCAATGCAAGCTGTAATGGGAAGTATGGCTGCTCAAGAAACTATGAAGGCGTGCTCCGGAAAATTCATGCCAGTTATGCAATGGATGTACTTTGACAGTTTGGAAAGTTTGAAAGTAGAAGATCGTAATGAAAACTCAGAAAACTACCAGCCACAAAACTCCAGATATGATGCACAAATTGCTGTATTTGGACGAGACTTCCAGAAGAAACTGAACTCTAGTAAATACTTTGTGGTTGGATCAGGAGCCATCGGTTGTGAGATGTTGAAGAATTTCGCAATGGTTGGTTTAGGTGCAAGCCCAGAGGGAAAGGTTTACGTCACTGATATGGATCTGATTGAAAAATCTAACTTGAACAGACAATTCTTATTCCGGCCACACGATGTCCAGCAAATGAAATCTTCAGTTGCAGCCAAAGCAGTTAAAGTAATGAATCCAGATATGAATATTGTTGCCCACCAAAATAGAGTAGGAACCGAAACTGAAAAAATTTATAACGATGACTTCTTTGAATCTTTGGATGGTGTTGCAAATGCGCTCGATAATATTGACGCCCGTATTTACATGGATCGTCGTTGTGTCTTCTATAAGAAACCTCTCCTGGAGTCTGGTACTCTTGGAACTAAAGGCAACGTACAGGTTGTGTTGCCAGAGGTTACTGAATCTTACAGCTCTTCACAAGATCCACCAGAAAAATCTATCCCAATTTGTACTTTAAAGAATTTCCCTAACGCCATCGAACACACTTTACAGTGGGCTCGTGATTCTTTCGAAGGATTGTTCACTCAAGGTCCTGAAACAACTACTCAATATATCAATGATCCCAAATTTATGGAACGTACATTGAAGCTTCAAGGTGTTCAACTTCTCGAAACCTTGGAAACAGTCGATAAAGCTATCAACAAACGGGCCAAAACATTTGATGATTGTGTGGCAATGGCTCGAATACTTTTCCAAGAATACTATCATAACACCATCGCACAATTATTATTCAACTTCCCTCCTGATCAAATGACCGAGTCAGGTGCACCATTCTGGTCTGGACCAAAAAGGTGCCCAAAGATTATCATATTCGACACTTCAAACGATCTTCACATGGACTTTATTGTGTCGGCTGCTAACTTGTTTGCTTTCAACGTCGGAGTTGAAGGAACCCGCGATAGAAATGTTGTGAAAAAGTCACTGGAAAGCGTAGAAGTGCCAGTGTTTGTTCCCAAATCAGGTGTCAAGATTTCAGTAACAGAACAAGAAGCGCAAAACAACGCAGCTGATTTAGACGACCAAAAGGTTGAAACCTTGAAAACGACTTTGCCAGATCCTGAAACATTAAAAGATTTGAAATACTTCCCAGCTGACTTCGAAAAGGACGATGATTCTAACTTCCATATGGACTTCATTGTCGCTTGCTCTAACCTTCGAGCTACCAACTACGAGATTGCACCTGCCGACAGACACAAGTCAAAACTAGTTGCTGGTAAAATCATTCCAGCCATTGCCACGACTACATCACTTGTTACTGGTCTAGTGTGTCTAGAGCTTTACAAGATCATCAACGGAAATAAATCCATTGAGAATTACAAGAATGGATTCATTAACTTGGCTTTACCTTTCTTTGGGTTCTCTGAACCTATGCCAGCACCCAAAATGAAGTACAACGATACAGAATTCACACTGTGGGACAGCTTTGAAATCCAAGGCAAGCAAGAAGATGGCTCCGAGATGACGTTGAAGCAACTTAAAGATTTATTTGAGGACAAATACAAGTTGGAGATTTCGATGATTTCTCAAGGTGTTGCCATGATTTACTCCTTCTTCATGCCACCTGCCAAAATGAAAGAACGATTAGAATCACCTATTTCAAAGACAGTCGAGAAAGTTTCGAAAAAGAAGATCAAACCTCATCAAAAAATTTTGGTCCTGGAATTATGCTGTAATGACAAAGACGGCGAAGATGTCGATGTGCCATATGTGAAATATTATCTCCCAGTGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q29504	Ubiquitin-like modifier-activating enzyme 1 OS=Oryctolagus cuniculus OX=9986 GN=UBA1 PE=1 SV=1
Q02053	Ubiquitin-like modifier-activating enzyme 1 OS=Mus musculus OX=10090 GN=Uba1 PE=1 SV=1
A3KMV5	Ubiquitin-like modifier-activating enzyme 1 OS=Bos taurus OX=9913 GN=UBA1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001418 (this species only) · gene tree & orthology
Ubiquitin family	E1\|ThiF\|ThiF · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10585 all species →	UBA_E1_SCCH	Ubiquitin-activating enzyme, SCCH domain	Domain	Interproscan
PF09358 all species →	E1_UFD	Ubiquitin fold domain	Domain	Interproscan
PF16191 all species →	E1_4HB	Ubiquitin-activating enzyme E1 four-helix bundle	Domain	Interproscan
PF00899 all species →	ThiF	ThiF family	Domain	Interproscan
PF16190 all species →	E1_FCCH	Ubiquitin-activating enzyme E1 FCCH domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR038252 all species →	Homologous_superfamily	Ubiquitin-activating enzyme E1, C-terminal domain superfamily	Interproscan
IPR019572 all species →	Domain	Ubiquitin-activating enzyme, SCCH domain	Interproscan
IPR042302 all species →	Homologous_superfamily	Ubiquitin-activating enzyme E1, FCCH domain superfamily	Interproscan
IPR018965 all species →	Domain	Ubiquitin-activating enzyme E1, C-terminal	Interproscan
IPR042063 all species →	Homologous_superfamily	Ubiquitin-activating enzyme E1, SCCH domain	Interproscan
IPR032420 all species →	Domain	Ubiquitin-activating enzyme E1, four-helix bundle	Interproscan
IPR000594 all species →	Domain	THIF-type NAD/FAD binding fold	Interproscan
IPR035985 all species →	Homologous_superfamily	Ubiquitin-activating enzyme	Interproscan
IPR018074 all species →	Conserved_site	Ubiquitin-activating enzyme E1, conserved site	Interproscan
IPR033127 all species →	Active_site	Ubiquitin-activating enzyme E1, Cys active site	Interproscan
IPR032418 all species →	Domain	Ubiquitin-activating enzyme E1, FCCH domain	Interproscan
IPR018075 all species →	Family	Ubiquitin-activating enzyme E1	Interproscan
IPR042449 all species →	Homologous_superfamily	Ubiquitin-activating enzyme E1, inactive adenylation domain, subdomain 1	Interproscan
IPR045886 all species →	Family	ThiF/MoeB/HesA family	Interproscan
IPR000011 all species →	Family	Ubiquitin/SUMO-activating enzyme E1-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10953 all species →	UBIQUITIN-ACTIVATING ENZYME E1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008641 all species →	Molecular Function	ubiquitin-like modifier activating enzyme activity	Interproscan
GO:0004839 all species →	Molecular Function	ubiquitin activating enzyme activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006511 all species →	Biological Process	ubiquitin-dependent protein catabolic process	Interproscan
GO:0006974 all species →	Biological Process	DNA damage response	Interproscan
GO:0016567 all species →	Biological Process	protein ubiquitination	Interproscan
GO:0032446 all species →	Biological Process	protein modification by small protein conjugation	Interproscan
GO:0036211 all species →	Biological Process	protein modification process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K03178	UBE1, UBA1; ubiquitin-activating enzyme E1	EC:6.2.1.45	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_066919835.1 across 40 RNA-seq samples of Clytia hemisphaerica. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

40Samples

40TPM > 0

16Conditions

252.2Max TPM

176.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
Mature medusa	5	5	220.85	252.16
medusa · Experiment Condition A1	4	4	164.57	174.26
medusa · Experiment Condition A2	4	4	150.11	156.89
medusa · Experiment Condition A3	4	4	151.98	157.70
Early gastrula	2	2	181.92	190.15
Planula 24hpf	2	2	193.34	201.08
Planula 48hpf	2	2	167.48	182.55
Planula 72hpf	2	2	172.52	187.57
Primary polyp	2	2	173.04	176.53
Gastrozooid	2	2	155.98	168.87
Gonozooid	2	2	184.34	184.88
Stolon	2	2	214.90	225.14
Baby medusa	2	2	151.66	151.66
medusa · Experiment Condition B1	2	2	187.80	199.76
medusa · Experiment Condition B2	2	2	178.93	182.93
Mixed	1	1	175.62	175.62

Per sample · hover a bar for the full sample record

Show the sample table (40 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
ERR2816251	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	252.16
ERR2816248	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	250.82
ERR2816250	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	246.89
ERR2816249	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	244.07
ERR2862245	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	110.31
ERR3299475	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	174.26
ERR3299476	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	173.63
ERR3299478	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	156.26
ERR3299477	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	154.11
ERR3299481	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	156.89
ERR3299482	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	148.99
ERR3299480	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	148.78
ERR3299479	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	145.77
ERR3299485	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	157.70
ERR3299486	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	153.28
ERR3299484	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	149.91
ERR3299483	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	147.03
ERR2816230	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	190.15
ERR2816231	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	173.69
ERR2816233	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	201.08
ERR2816232	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	185.59
ERR2816235	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	182.55
ERR2816234	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	152.41
ERR2816236	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	187.57
ERR2816237	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	157.47
ERR2816238	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	176.53
ERR2816239	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	169.54
ERR2816241	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	168.87
ERR2816240	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	143.08
ERR2816242	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	184.88
ERR2816243	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	183.79
ERR2816245	Stolon	not recorded	Stolon	not recorded	ERP110164	225.14
ERR2816244	Stolon	not recorded	Stolon	not recorded	ERP110164	204.65
ERR2816247	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	151.66
ERR2816246	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	151.65
ERR3299472	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	199.76
ERR3299471	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	175.84
ERR3299474	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	182.93
ERR3299473	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	174.93
ERR2862244	Mixed	not recorded	Mixed	not recorded	ERP110164	175.62

Source: CnidoSite RNA-seq expression matrices (CHEMI_TPM, StringTie quantification over 40 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Clytia hemisphaerica tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	7	XP_066923567.1	0.814653215882795
Negatively correlated	6	XP_066930919.1	-0.618976488448681

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Clytia hemisphaerica, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →