Gene detail

Detailed information of XP_066920930.1 in Clytia hemisphaerica

Genomic Location: NW_027103858.1:139746...169794
NR annotation: XP_047126355.1, coatomer subunit alpha-like [Hydra vulgaris]
Species Clytia hemisphaerica · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_066920930.1

ATGCTAACCAAATTCGAAACAAAATCAGCTCGAGTGAAAGGTATTTGCTTTCATTCCAAGAGACCATGGGTGTTGGCAAGTCTTCACAATGGTGTTATCCAGTTATGGGATTATCGAATGTGTACATTGTTAGAAAGATTTGATGAGCACGATGGCCCTGTTCGTGGAATCCATTTTCATGAGCACCAACCGCTTTTTGTCTCTGGTGGTGATGATTATAAAATCAAGGTCTGGAATTATAAGCAAAAGAAGTGCATTTTCACTTTGTTGGGTCATCTGGATTACATTCGAACAACTTTCTTTCATCATGAATATCCGTGGATTTTGAGTTGCTCAGATGATCAAACTATACGAATTTGGAACTGGCAGTCTCGCAATTGTATCAGTGTTTTGACTGGTCATAACCACTATGTTATGTGCGCTCAATTTCATCCAACTGAAGACTTGATTGTATCTGCATCATTAGATCAAACAGTCAGAGTGTGGGATTTTGGAGGGCTTCGTAGAAAGTTTGTTTCCCCAGGAGCCAAAGCCAAGGAAGAGACTGGTCCTAAGACCCCTGGCCAAATGGACTTATTTGGTCAAGCTGATGCTATTGTTAAACATGTCTTAGAGGGACATGACCGTGGTGTCAACTGGGTTGCCTTTCATCCTTCGATGCCCTTCATAGTATCAGCTGCTGATGATAGACAAGTCAAGCTGTGGAGAATGAATGATGCAAAAGCTTGGGAAGTTGACACCTGTCGGGGTCATTACAACAATGTCTCATCAGCACTTTTCCATCCAAGACAAGAGCTTATCATCAGTAATTCAGAGGACAAGAGCATCAGAGTTTGGGACATGTCAAAGAGAACTGGAGTACAAACATTCAGACGTGAACATGATCGATTTTGGACTCTTGCGGCCCATCCAACTCTTAACCTTTTTGCTGCAGGTCATGACAGTGGTATGCTTGTTTTCAAGCTGGAAAGAGAAAGACCAGCATATACCGTTCATCAAAACACATTGTATTACGTCAAGGATCGATACCTGCGAATGTATGAATTCGGCACATCGAAAGACATCCCTGTTATGCAATTCAGAAAGGGCTCAAGTAAACCATCACCTGTCAATTTGATGTACAACCCTGCTGAACGATGTATTCTTTTAACCTATGCCACAAGCTCAACTTCAAACGACCAAATCTATGAGTTACACCTTTTGCCAAAAGATATTCGATCATCTGATCCTGAAACATCTGAAGGTCGTAGAGCAGCTGGTATTGATGCTATTTGGGTTGCAAGAAACAGATTTGCTGTACTTGACAAAACTCAAAGTGTTGTCATCAAAAATCTTAAGAATGAGGTCACAAAGAAGGTGCAAACACCACCTTGCGATAAAATCTTTTATGCTGGCACTGGCAGTTTGTTGTTGCGAGATAGCGACCAAGTCATGTTGTTTGATGTCCAGCAAAAGAGAGTTGTTGCAACAGTTAAAATTTCAAAAGCAAGAAATGTTATTTGGTCTTCGGATATGAGCTATGTTGCTGTTGTTTCTAAGCATTCCATTGCCATTTGTAATCGTAAAATGGAGAACCTGTGTAACATTCATGAAAGTGTGAAGATCAAGGGCGGTGCTTGGGACGATTCGGGCGTTCTTGTTTATACCACCAGCAATCACATCAAGTACACTCTCACAAATGGTGACAGTGGAATCATCAGAACATTGGATATGCCAATATACATCACCAAAGTCAAAGGAAGCAGTATTTACTGTTTGGATCGTGAATGTAAAACTCGAGTTTTGGGTATCGACCCTACTGAATTCAAATTCAAACTGGCCTTGGTCAACCACCGTTACGATGAAGTTCTTCACATGGTGCGAAACGCTAAGTTAGTCGGACAATCCATCATCGCTTACCTTCAAAAGAAAGGATATCCAGAGGTTGCCTTACATTTTGTAAAAGACGAAAAGACACGATTCGGTCTTGCTCTGGAGTGTGGAAATTTGGAGATTGCATTAGAAGCAGCCAAATCACTGGATGATAAAGCATGTTGGGAGAAGTTGAGCGATATGGCTCTTGCACAAGGAAACCACCAGGTTGTAGAAATGTGCTATCAACGAACGAAGAATTTCGATCGCTTGTCATTCTTATACTTGACTACTGGAAATAGTGACAAATTGCAGAAGATGACAAAAATCTCTGAGATTCGAAAGGACGTTAGTGGCCATTTACATAATGCATTGTATACCGGAGATGTCGAGGAAAGAATCAAAGTGCTCAAACAAGTCGGGCAAGGTTCACTGGCGTACTTGACTGCTGCTACTCACGGCCTTGCCGCCGAATGTGAAGAAATCAAAGCTCAATTCAACTTAGACCCGGAGAAGTTGCCAGCCATTAATCCAAACGCCAAATTACTTCGTCCACCCGTTCCCATCTTAAAGAATGAATCCAACTGGCCCTTATTGACAGTTAGCAAAACATTATTCGAGGGTGCTGCTTCTTCTATGAAAGAAGGAGCAGCTTCGTCAATGGCAGCGGCAGATGTTGGTGATATGGGAGACGAAGGAGGATGGGGTGATTCTGATCTCGTACTCGACGAAGACGCAGGCTTTGGAGATCCAGACGAGAAATTAGAGATCGATGAAGAAGGAGGTGGTTGGGATGTCGGTGATGATGATTTGGAACTACCTGCTGATCTGGACGTTGGACCAATGCCAGCAGGTGGCGGTGAAGATTATTACGTGCCGCCTACACGTGGTAATAACCAATCGCAAGTCTGGTGTAATAATTCACAAATTCCTGTCGATCACCTTGTCGCCGGATCGTTTGATTCCGCAGCTAGACTGATGAACGAACAATTAGGCGTAATCAATTTCGAACCATACAAACAACTCTTCATGTCGGCTTTCTCACGAGGGCGGGCCGTGTCTCCTGGTCTTCCCACCACGCCGCCCATGTTTTACCACCCTCACAGAAATTGGAAAGAGGCAGGCGCTAAGGCTGGTCTACCTGCCATCGGAATGAAACTGAACGATTTAATTCAACGGTTACAGTCATCATATCAATTAACGACTGGTGGTAAATTTGCGGACGCGGTAGAGAAGATGCATCAAATTCTATTGAGTATCACGTTATTAGCCGTGGACAGTAAACAAGATGTGACAGAGGCACAACAGCTTCTTAGTATCTGTAGAGAATATTTGGTCGGCCTTGGAATGGAATTACAACGCAAAGAATTACCTAAACAAACGGCTCCACAACAGAAACGACTTTGCGAGATGGCAGCTTACTTTACACATTGCAACCTACAACCCATACATTTAATCTTAACATTACGTACAGCGTGTAACTTATGTTTCAAGATCAAGAATTTCAAAACTGCAGCGTCATTCGCTAGACGGTTAATAGAATTGGGACCACGTCCTGAAGTAGCACAACAGACACGAAAAATCTTACAAGCATGCGAAAAGAACCCAACGAACGCTGTCGATCTTGATTACGATGAACTTAATCCTTTCTCCTTGTGTTGCGTCTCTTACACGCCAATCTACCGTGGAAAACCTGAAGAAAAATGTCCACTATGCGGAGCCTCATATAAACCGGAATACAAGGGAACCGTATGCAAAATATGCCGGGTTGCTGAAGTTGGGCGACCGGCATCTGGTTTGAAGATTACGAATAGTTCTCGCTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P53621	Coatomer subunit alpha OS=Homo sapiens OX=9606 GN=COPA PE=1 SV=2
Q27954	Coatomer subunit alpha OS=Bos taurus OX=9913 GN=COPA PE=1 SV=1
Q8CIE6	Coatomer subunit alpha OS=Mus musculus OX=10090 GN=Copa PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004731 (this species only) · gene tree & orthology
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF06957 all species →	COPI_C	Coatomer (COPI) alpha subunit C-terminus	Repeat	Interproscan
PF04053 all species →	Coatomer_WDAD	Coatomer WD associated region	Repeat	Interproscan
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR010714 all species →	Domain	Coatomer, alpha subunit, C-terminal	Interproscan
IPR016391 all species →	Family	Coatomer subunit alpha	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR020472 all species →	Repeat	G-protein beta WD-40 repeat	Interproscan
IPR050844 all species →	Family	Coatomer complex subunit	Interproscan
IPR047312 all species →	Domain	Coatomer subunit alpha, WD Associated Region	Interproscan
IPR006692 all species →	Domain	Coatomer, WD associated region	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR19876 all species →	COATOMER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005198 all species →	Molecular Function	structural molecule activity	Interproscan
GO:0006886 all species →	Biological Process	intracellular protein transport	Interproscan
GO:0016192 all species →	Biological Process	vesicle-mediated transport	Interproscan
GO:0030126 all species →	Cellular Component	COPI vesicle coat	Interproscan
GO:0006888 all species →	Biological Process	endoplasmic reticulum to Golgi vesicle-mediated transport	Interproscan
GO:0006890 all species →	Biological Process	retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum	Interproscan
GO:0006891 all species →	Biological Process	intra-Golgi vesicle-mediated transport	Interproscan
GO:0030117 all species →	Cellular Component	membrane coat	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05236	COPA, RET1; coatomer subunit alpha	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_066920930.1 across 40 RNA-seq samples of Clytia hemisphaerica. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

40Samples

40TPM > 0

16Conditions

227.6Max TPM

88.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
Mature medusa	5	5	76.91	105.17
medusa · Experiment Condition A1	4	4	81.02	86.98
medusa · Experiment Condition A2	4	4	94.28	97.96
medusa · Experiment Condition A3	4	4	36.13	44.30
Early gastrula	2	2	116.80	120.02
Planula 24hpf	2	2	217.11	227.56
Planula 48hpf	2	2	120.15	138.77
Planula 72hpf	2	2	93.30	103.90
Primary polyp	2	2	63.25	64.55
Gastrozooid	2	2	53.86	63.23
Gonozooid	2	2	111.41	118.50
Stolon	2	2	102.22	113.72
Baby medusa	2	2	65.50	66.15
medusa · Experiment Condition B1	2	2	63.10	69.41
medusa · Experiment Condition B2	2	2	99.97	103.89
Mixed	1	1	83.61	83.61

Per sample · hover a bar for the full sample record

Show the sample table (40 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
ERR2862245	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	105.17
ERR2816249	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	86.85
ERR2816248	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	70.52
ERR2816251	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	64.14
ERR2816250	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	57.89
ERR3299476	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	86.98
ERR3299475	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	83.64
ERR3299477	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	77.68
ERR3299478	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	75.79
ERR3299481	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	97.96
ERR3299482	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	94.71
ERR3299479	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	92.93
ERR3299480	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	91.52
ERR3299483	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	44.30
ERR3299484	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	40.92
ERR3299485	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	30.06
ERR3299486	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	29.24
ERR2816230	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	120.02
ERR2816231	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	113.57
ERR2816233	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	227.56
ERR2816232	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	206.66
ERR2816235	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	138.77
ERR2816234	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	101.53
ERR2816236	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	103.90
ERR2816237	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	82.70
ERR2816238	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	64.55
ERR2816239	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	61.95
ERR2816241	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	63.23
ERR2816240	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	44.48
ERR2816242	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	118.50
ERR2816243	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	104.33
ERR2816245	Stolon	not recorded	Stolon	not recorded	ERP110164	113.72
ERR2816244	Stolon	not recorded	Stolon	not recorded	ERP110164	90.72
ERR2816247	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	66.15
ERR2816246	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	64.86
ERR3299472	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	69.41
ERR3299471	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	56.79
ERR3299474	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	103.89
ERR3299473	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	96.04
ERR2862244	Mixed	not recorded	Mixed	not recorded	ERP110164	83.61

Source: CnidoSite RNA-seq expression matrices (CHEMI_TPM, StringTie quantification over 40 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Clytia hemisphaerica tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	39	XP_066914805.1	0.953850503772404
Negatively correlated	5	XP_066914344.1	-0.734509315230751

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Clytia hemisphaerica, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →