Gene detail

Detailed information of XP_066924572.1 in Clytia hemisphaerica

Genomic Location: NW_027104045.1:20576...75921
NR annotation: XP_002166379.2, DNA ligase 4 [Hydra vulgaris]
Species Clytia hemisphaerica · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_066924572.1

ATGGCTGCACCGAGTGATGACACAGCAACAAGCAAGACGATTGCATCTGAAGTTCCTTTCCATGATTTTGCCGTTCTTTGTGAGAAAATCAGTAAAACACAAGGCAAAGAGCGAAAGAAAGCTCTGATGCAAAAGTTTATTGGTCATTGGCGGAGGTCACATCAAAAGATGCATGGCAACCAAAAAACTGTGGTCTTAGCGAAATATTATATCGAAGCACTTGGTTTATCAAAAGATAGTACAGACGCCAAAAAGTTGCTCAATTATCGTGCACCGAATTCTGCAAAACAGGAAGCTGGCGATTTCGCATCAGTAGCGTTCGTCATTTTGAAAAGTCGATGTCCAGAACAAGGGAGCATGACAATCGAGAACATTAACAATGCATTAGACTCGATTGCACAAGCAAATGTTGAAAAAGAACGTGATACAGCTAAAGCTACCATTTTGAAAGTCATTCGAACGACAAGTGCATTAGAACAGAAATGGTTTATCAGAGTCATGTTGAAGGAGATGAAGTTTGGGTTAAACGAGAACAGTATTTTTCCCTTATATCATAAAGATGCTTTGGAACTTTTCAATGTCTGCAACAGTCTTTCAAAGGTGTGTTTGGATCTCCACGATGAAAATATTGAATTGAACGAGACAGAGATCTCCCTCTTCACACCATTTCGTCCGATGCTTGGTCAACGGGTGGTGCTCGAAGATGTGGAGAAGTTGATGCATCACCGTCATTTCATCATCGAAACCAAAATTGATGGTGAAAGAATGCAAATGCATAAAAATGAAGATGAGTACAGATATTTCTCAAGGAATTCGAACGATTATTCAGAGAATTTTGGTATCACCAAATACCGTGGAAGTTTCACACCTCACGTTACACACTTATTCAAAGAAGACATCAAAACCTGTATACTTGATGGCGAAATGGTCGGATTCGATGATGAAATCGATAATTTTGTACTCAAAGGATCGAATATCGACATCAAATCAGACCATTTGGTTGGTGTTCATCCATGTTTTGTGGTTTTTGACGTTCTGATGGTGAACGGAGAAAACCTAGCAAACGTTCCGTTAGAAGATCGAATCAAAAGAACCGAAACGTTGTTCGATTCTGAACGTGGCCGGCTGGAAATCGTTGAAAGGAAACTTGGTAAATCTAAGGAGGACGTGATCAACTCAATCAACAAAGCGGTAGACAAACGTGAAGAAGGGATCGTCATCAAAGATCCTTCATCTATCTATAAACCAAGTAAACGAAAAGGTAGCGGTTGGTTGAAATTGAAGCCAGAGTACGTTGACGCTTTGGGTGATGATTTGGATCTCATCATTCTTGGTGGTGAATACGGATCCGGTAAACGCCGTGGCGGGATGATTTCTCATTTCTTGTTGGGCGTGGCTGTCACTCCTGATACTCCTGGTGAACGACCAACCAAATTCATGACGTTTGGCAAGGTGGGTTCAGGATACTCAGACAAAGAATTGAAATCAATTTGCGATCAACTGAATCCTCATTGGAAGAAGTTTCAAGGACCGACATCCTCGATTATCTTCACCGATGGCTGTAAGGAAAAACCTGACGTTGTTATTGAACCACGTGACTCGATAATAGTTCAGATCAAAGCTTCCGAAATTACACCATCAGACAAATACAAATGCCAATGCACCATGAGGTTTCCACGTATGGAACGAGTGAGAGATGATAAATCGTGGTTTGAGTGCATGACCTTTGACGAGCTCGAAGAAATGAAAAAGATGGCGGACGGGCGCCTATCGTACAAACAGAAAGTCAGTGGTGATGCAGAAGACACTGAAGATGGACCTTCGTCCAAGAAGAAGCGGCGCACTGTGCTTCGTGTGGAACGCCCACGAAGTGTGGCTCAACATCTAAAAGGTGCCGACATCACAGACATCCAGGAAGTATCAAACTGGTTGAATGAGACTGAATTTTGTGTTATAAATGGTCCGACTGAATTTTCTAAACAAAAACTGGAGCAATTCATAGTTGAGAACGGTGGTACGTTCGTGCAAAATCCCACCGCTGAAACAAAATGTGTTATCGTAGAGAAAACAAACTTCAGAGCTAAGAACATTATCAGTCGTGAAAATGTGGATGTTGTCAAAGCATCATGGTTCATTCGATGTCTGGAAGAGAAACAGATGAACACGTATCAACCCTCTGACATCATATTCGCTACGGAGACCACCAAAAGCACTTTCAACCAAAACTATGACCAATATGGCGACCACTACACTCAAGACATCGAAAACCCGAACGAACTCAAACAGATTTTCGACGGTATCAATGCGGATAGTGAAAAGAATCATATTCAAGTTTCAGATATTGCAAACATTGAACAAAGATATTTTCATGGGACGTCCAAGTACTCCATCTTTCGGCGATGCAGACTATTCGTACCAACGGCGGAGGTTCCGAATTACCCTTACAAGAACATGATGGAATTTGTGAGCCTAGAATATTGTTTACATGGTGGTACGATTGTCCGAAATATTGATCAAGCTACACATATCCTTCTCTCGCAAAGTGACGATCTGGCCGTCCAGGACATACGTGCAATAATCCGAACGAAACGAGTCAAGCCTCAGGTTATCACAGAACTTTGGATTCGTGATAGTATCGATCAGAACAAAATGTTGGAAGAACGACCTTATAAACCTGCGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5R6L3	DNA ligase 4 OS=Pongo abelii OX=9601 GN=LIG4 PE=2 SV=1
P49917	DNA ligase 4 OS=Homo sapiens OX=9606 GN=LIG4 PE=1 SV=2
Q90YB1	DNA ligase 4 OS=Gallus gallus OX=9031 GN=LIG4 PE=2 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002879 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04675 all species →	DNA_ligase_A_N	DNA ligase N terminus	Family	Interproscan
PF00533 all species →	BRCT	BRCA1 C Terminus (BRCT) domain	Family	Interproscan
PF04679 all species →	DNA_ligase_A_C	ATP dependent DNA ligase C terminal region	Family	Interproscan
PF01068 all species →	DNA_ligase_A_M	ATP dependent DNA ligase domain	Domain	Interproscan
PF11411 all species →	DNA_ligase_IV	DNA ligase IV	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001357 all species →	Domain	BRCT domain	Interproscan
IPR029710 all species →	Family	DNA ligase 4	Interproscan
IPR012308 all species →	Domain	DNA ligase, ATP-dependent, N-terminal	Interproscan
IPR036420 all species →	Homologous_superfamily	BRCT domain superfamily	Interproscan
IPR012309 all species →	Domain	DNA ligase, ATP-dependent, C-terminal	Interproscan
IPR012310 all species →	Domain	DNA ligase, ATP-dependent, central	Interproscan
IPR036599 all species →	Homologous_superfamily	DNA ligase, ATP-dependent, N-terminal domain superfamily	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan
IPR000977 all species →	Family	DNA ligase, ATP-dependent	Interproscan
IPR044125 all species →	Domain	DNA Ligase 4, adenylation domain	Interproscan
IPR016059 all species →	Conserved_site	DNA ligase, ATP-dependent, conserved site	Interproscan
IPR021536 all species →	Domain	DNA ligase IV domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45997 all species →	DNA LIGASE 4	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0003910 all species →	Molecular Function	DNA ligase (ATP) activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0005958 all species →	Cellular Component	DNA-dependent protein kinase-DNA ligase 4 complex	Interproscan
GO:0006281 all species →	Biological Process	DNA repair	Interproscan
GO:0006297 all species →	Biological Process	nucleotide-excision repair, DNA gap filling	Interproscan
GO:0006303 all species →	Biological Process	double-strand break repair via nonhomologous end joining	Interproscan
GO:0032807 all species →	Cellular Component	DNA ligase IV complex	Interproscan
GO:0051103 all species →	Biological Process	DNA ligation involved in DNA repair	Interproscan
GO:0006310 all species →	Biological Process	DNA recombination	Interproscan
GO:0071897 all species →	Biological Process	DNA biosynthetic process	Interproscan
GO:0003909 all species →	Molecular Function	DNA ligase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10777	LIG4, DNL4; DNA ligase 4	EC:6.5.1.1	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_066924572.1 across 40 RNA-seq samples of Clytia hemisphaerica. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

40Samples

39TPM > 0

16Conditions

11.9Max TPM

6.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
Mature medusa	5	5	10.66	11.87
medusa · Experiment Condition A1	4	4	4.22	4.91
medusa · Experiment Condition A2	4	4	4.47	4.97
medusa · Experiment Condition A3	4	3	3.48	4.93
Early gastrula	2	2	3.98	4.04
Planula 24hpf	2	2	7.43	7.64
Planula 48hpf	2	2	6.92	7.47
Planula 72hpf	2	2	7.13	8.16
Primary polyp	2	2	7.67	8.00
Gastrozooid	2	2	5.83	5.93
Gonozooid	2	2	9.98	11.37
Stolon	2	2	8.02	8.68
Baby medusa	2	2	6.90	7.43
medusa · Experiment Condition B1	2	2	5.95	6.42
medusa · Experiment Condition B2	2	2	5.74	5.92
Mixed	1	1	11.35	11.35

Per sample · hover a bar for the full sample record

Show the sample table (40 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
ERR2816251	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	11.87
ERR2816248	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	11.75
ERR2816249	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	10.95
ERR2862245	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	9.78
ERR2816250	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	8.92
ERR3299476	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	4.91
ERR3299475	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	4.24
ERR3299477	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	3.87
ERR3299478	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	3.87
ERR3299479	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	4.97
ERR3299482	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	4.66
ERR3299480	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	4.47
ERR3299481	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	3.79
ERR3299485	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	4.93
ERR3299484	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	4.69
ERR3299483	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	4.32
ERR3299486	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	0.00
ERR2816231	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	4.04
ERR2816230	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	3.92
ERR2816232	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	7.64
ERR2816233	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	7.22
ERR2816235	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	7.47
ERR2816234	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	6.37
ERR2816236	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	8.16
ERR2816237	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	6.10
ERR2816238	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	8.00
ERR2816239	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	7.33
ERR2816240	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	5.93
ERR2816241	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	5.74
ERR2816243	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	11.37
ERR2816242	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	8.60
ERR2816245	Stolon	not recorded	Stolon	not recorded	ERP110164	8.68
ERR2816244	Stolon	not recorded	Stolon	not recorded	ERP110164	7.36
ERR2816246	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	7.43
ERR2816247	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	6.36
ERR3299471	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	6.42
ERR3299472	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	5.48
ERR3299473	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	5.92
ERR3299474	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	5.57
ERR2862244	Mixed	not recorded	Mixed	not recorded	ERP110164	11.35

Source: CnidoSite RNA-seq expression matrices (CHEMI_TPM, StringTie quantification over 40 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Clytia hemisphaerica tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	11	XP_066929451.1	0.89118399180383
Negatively correlated	13	XP_066926143.1	-0.77727857734372

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Clytia hemisphaerica, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →