Gene detail

Detailed information of XP_066926827.1 in Clytia hemisphaerica

Genomic Location: NW_027104166.1:434596...448775
NR annotation: XP_047143209.1, sodium/calcium exchanger 2 isoform X2 [Hydra vulgaris]
Species Clytia hemisphaerica · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_066926827.1

ATGGCGTCGAACGTCACTTATATTTACCAATGTCCTGACATGTACAAATGCAGTAAAGTAAATCAAGGGACTCTGTTTTTGCCGCTCTTCAACGAATCTGATTGGCCACTTGCTCTTCGAGTTGTATTGTATCTGTTAACCATGCTTTGGTTTTTCATGGGCGTTGCCATTGGTGCTGATTTATTCATGTGTGCAATCGAAGTGATCACCAGTAAAACAAAAACGTTACGAGTAGCCAATGAAGAAGAAGCTAAAGGTTATGAAGAAGTTGAAATCCGCGTCTGGAATGACACTGTTGCCAATCTCACTCTAATGGCTCTCGGTAGCTCTGCACCCGAAATCCTTCTCTCAGTTATTGAGATTGTGAGCAAAGGATTCAAAGCTGGTGAACTCGGTCCTGGTACTATTGTAGGGAGTGCAGCTTTTAATCTACTCTGCATCACAGCATGTTGTGTAATGGCTGTCGATAAACCAAAGCGAATCAACTCGTTCAACGTCTTTTTAATAACGGCGTTTTTCTCTGTTTTTGCTTACATCTGGCTTTTCATGGTCATTTCTATCATCTCCAAAAATAGGGTGGACATCTGGGAAGCTGTCATTACCTTACTTTGGTTCCCTATTTTGGTTATCCTGGCATACATCGCTGATAAAAACTTGTGTGGTAATTTCGCTTTCTTGAAGAAGAATAAAGAACGAATTGAACTCAACAATATGGATTTATTAGACGAGAAAGTGTTGAAGAAACACAGACCAGATCTCATCGAATATATGAAGGAGATCACATCCAACCCAGCATTAACAGAAGATGAAGCTGCAAAATTGATTGCCATCAAAATGGAACAATCGAAAAAGAAGAATTACGGATACTATCGTGTCGGCGCCCTTCGAAGTATCGGCGGTGGCCGAAAAGTGGTGCCCACGATCCCTGATAAACTGAAACCTCTGGTATCTGATGGACCTGGTGCAAAACTTCTTGTTGACGCTGATCCACTCACACCAAGAGTGGAGTTTGTTGCAACTGCCGTATCTGTTTTGGAAAGTGCCAAAGTCGCTCAATTAACGTTGGTCAGATCAAGAAATTTATCAGAGAAGATCACCATCAGATATGAGACTATTGACGGTACAGCTGAGGCGGGATCAGATTACATTGCCAAGAAAGGAACATTGACTTTTGAACCACAAGAAACAACAAAACAATTAGAGGTTGTTATCATCGATGATTATGAGTGGGAGCCCGATGAGACGTTCTTTATCAAATTACATTCCGATGTTGAAGAAAGCAAAAATGTCGAGATTGGACCACACTCCATCGCTGAAGTCACCATTATCAACGACGATGAACCTGGTACGATTGGTTTCACCAAGCCATCACACATTGTGAAAGAGAGTTGTGGCAAAGCCGAAGTAGAAGTCGAACGTGTCAACGGAGCTGATGGAAAAGTTGAATTGGTTTGGAAAACTAAAGATCAATCTGCCCTCCATGGAAAAGATTACATCGGTGGAGAGGGAACATTGATTTTCGAGCACGGAGAAACTGTAAAAACGATTGATATTGAAATTATTGATGATCATCAATTCGAAAAAGATGAAACTTTTATGATCGAATTTACCGACTTGAAAACACAGGGAGCGAAATTTGGACGTTTGAAGAAAACAGTCGTGACTGTCGTAAGCGATGATGAATACCGCCGTATGTTTGACCGTGTTGTGCACATGGCCCATTTGAACATGGATAAATTTGAGTTGGGATCAGCTACGTGGGGACAACAATTTACCGAAGCGATGAGTGTAAACGGAGGTGACGTTGAAAATGCAACAGCATTGGATTATGGGATGCATTTTGCTACTTTCTTCTGGAAGGTTTTGTTCGCTTTCGTTCCTCCCTGCTCTTGGTACGGTGGATGGTTATCTTTCGTCATTATCTTGGCAATGATTGGTATAATGACTGCTTTGATTGGTGATATCGCTACCATCTTTGGTTGTCTCATCTCTCTCAAACCTGAAGTCACTGCTATCACATTCGTCGCCTTAGGAACCAGTTTACCTGATTTGTTTGCCAGTAAGAATGCAGCTTGCAATGAAGAATATGCTGACGCAGCTATTGGTAACGTCACTGGAAGTAACGGAGTCAATGTTTTCTTGGGTCTTGGTATCCCATGGGTCATTGCAACCATCTACCACAAAATCAAGGGCTCAACTTTCGACGTTTCAGCCGGCTCCTTAGCAACCAGTGTCGTCACATACGCCGTTTGTGCTACCATTTGTATCTTTTTACTCATCGCAAGACGTTTCATTCCCGCCTTCGGTGGCGGTGAGTTGGGCGGCCCTAAAGCGATTCGATTCGCAACGGGTGGTTTCATGATTTTCTTATGGTTTGTTTACCTCTTGGTGTCCTCGCTTGTTGCTTACGGTCATTTAAGCCCTATCTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P48766	Sodium/calcium exchanger 1 OS=Cavia porcellus OX=10141 GN=SLC8A1 PE=2 SV=1
P23685	Sodium/calcium exchanger 1 OS=Canis lupus familiaris OX=9615 GN=SLC8A1 PE=1 SV=1
P48767	Sodium/calcium exchanger 1 OS=Felis catus OX=9685 GN=SLC8A1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001091 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03160 all species →	Calx-beta	Calx-beta domain	Domain	Interproscan
PF01699 all species →	Na_Ca_ex	Sodium/calcium exchanger protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR003644 all species →	Domain	Na-Ca exchanger/integrin-beta4	Interproscan
IPR038081 all species →	Homologous_superfamily	CalX-like domain superfamily	Interproscan
IPR004837 all species →	Domain	Sodium/calcium exchanger membrane region	Interproscan
IPR004836 all species →	Family	Sodium/calcium exchanger protein	Interproscan
IPR044880 all species →	Homologous_superfamily	NCX, central ion-binding domain superfamily	Interproscan
IPR051171 all species →	Family	Calcium/Cation Antiporter	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11878 all species →	SODIUM/CALCIUM EXCHANGER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0007154 all species →	Biological Process	cell communication	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0005432 all species →	Molecular Function	calcium:sodium antiporter activity	Interproscan
GO:0006816 all species →	Biological Process	calcium ion transport	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0015491 all species →	Molecular Function	obsolete cation:cation antiporter activity	Interproscan
GO:0030001 all species →	Biological Process	metal ion transport	Interproscan
GO:0030424 all species →	Cellular Component	axon	Interproscan
GO:0035725 all species →	Biological Process	sodium ion transmembrane transport	Interproscan
GO:0042383 all species →	Cellular Component	sarcolemma	Interproscan
GO:0098703 all species →	Biological Process	calcium ion import across plasma membrane	Interproscan
GO:0098794 all species →	Cellular Component	postsynapse	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05849	SLC8A, NCX; solute carrier family 8 (sodium/calcium exchanger)	-	Glycosaminoglycan binding proteins	ko00536	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_066926827.1 across 40 RNA-seq samples of Clytia hemisphaerica. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

40Samples

40TPM > 0

16Conditions

669.1Max TPM

183.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
Mature medusa	5	5	76.57	114.84
medusa · Experiment Condition A1	4	4	33.70	39.31
medusa · Experiment Condition A2	4	4	211.12	211.85
medusa · Experiment Condition A3	4	4	323.87	388.30
Early gastrula	2	2	265.36	269.15
Planula 24hpf	2	2	651.88	669.12
Planula 48hpf	2	2	333.66	394.85
Planula 72hpf	2	2	158.08	166.16
Primary polyp	2	2	133.17	150.99
Gastrozooid	2	2	162.59	186.87
Gonozooid	2	2	173.69	192.31
Stolon	2	2	82.92	93.75
Baby medusa	2	2	164.29	165.33
medusa · Experiment Condition B1	2	2	60.06	61.64
medusa · Experiment Condition B2	2	2	93.99	100.34
Mixed	1	1	122.21	122.21

Per sample · hover a bar for the full sample record

Show the sample table (40 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
ERR2816251	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	114.84
ERR2816250	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	107.02
ERR2816249	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	70.58
ERR2816248	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	59.96
ERR2862245	Mature medusa	not recorded	Mature medusa	not recorded	ERP110164	30.47
ERR3299476	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	39.31
ERR3299475	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	36.99
ERR3299478	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	29.80
ERR3299477	medusa · Experiment Condition A1	not recorded	medusa	Experiment Condition A1	ERP115020	28.69
ERR3299479	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	211.85
ERR3299481	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	211.83
ERR3299482	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	211.62
ERR3299480	medusa · Experiment Condition A2	not recorded	medusa	Experiment Condition A2	ERP115020	209.17
ERR3299485	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	388.30
ERR3299486	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	377.82
ERR3299483	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	267.78
ERR3299484	medusa · Experiment Condition A3	not recorded	medusa	Experiment Condition A3	ERP115020	261.58
ERR2816230	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	269.15
ERR2816231	Early gastrula	not recorded	Early gastrula	not recorded	ERP110164	261.57
ERR2816233	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	669.12
ERR2816232	Planula 24hpf	not recorded	Planula 24hpf	not recorded	ERP110164	634.65
ERR2816235	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	394.85
ERR2816234	Planula 48hpf	not recorded	Planula 48hpf	not recorded	ERP110164	272.46
ERR2816237	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	166.16
ERR2816236	Planula 72hpf	not recorded	Planula 72hpf	not recorded	ERP110164	150.00
ERR2816238	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	150.99
ERR2816239	Primary polyp	not recorded	Primary polyp	not recorded	ERP110164	115.35
ERR2816241	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	186.87
ERR2816240	Gastrozooid	not recorded	Gastrozooid	not recorded	ERP110164	138.32
ERR2816243	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	192.31
ERR2816242	Gonozooid	not recorded	Gonozooid	not recorded	ERP110164	155.07
ERR2816245	Stolon	not recorded	Stolon	not recorded	ERP110164	93.75
ERR2816244	Stolon	not recorded	Stolon	not recorded	ERP110164	72.09
ERR2816246	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	165.33
ERR2816247	Baby medusa	not recorded	Baby medusa	not recorded	ERP110164	163.25
ERR3299472	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	61.64
ERR3299471	medusa · Experiment Condition B1	not recorded	medusa	Experiment Condition B1	ERP115020	58.48
ERR3299473	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	100.34
ERR3299474	medusa · Experiment Condition B2	not recorded	medusa	Experiment Condition B2	ERP115020	87.65
ERR2862244	Mixed	not recorded	Mixed	not recorded	ERP110164	122.21

Source: CnidoSite RNA-seq expression matrices (CHEMI_TPM, StringTie quantification over 40 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Clytia hemisphaerica tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	33	XP_066932186.1	0.930200504659285
Negatively correlated	4	XP_066915046.1	-0.756171495994018

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Clytia hemisphaerica, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →