Gene detail

Detailed information of XP_074606376.1 in Acropora palmata

Genomic Location: NC_133893.1:20982461...20999181
NR annotation: XP_029207159.2, X-ray repair cross-complementing protein 5-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074606376.1

ATGTGTCAGGCTTCCCCCGGACACGCCACGTCATTGGAGACTTCAGTCAAGGCCATCAACATGATCATACAGAGGAAGATGTTTGCAAACACAAAAGATGAATTTGGTTTAATTCTATTTGGCACTGAAGGAACGTGTAATCGTCTGAATGACGAAGGAAGTTATGAAAATATCACTGTTGCACGCCATCTTGGTTTACCAGACTTGGAAATGCTTCAGTTTGTACACAGTCAGATCACACCTGGAAATGTGGAAACAGACTTTATTGATGCCATTGTAGTTGGTATGGACTTGTTACGTGAGGAGAGCAAGGGAAAGTGTGAGAAAAAGGTTTATTTATTTTCTGATCTTGGTTCTCCTTTTGGAAATGATCAACTGGACACAATCACTGAAGGATTAAAAAGCTTAGAGATTCAGTTGACCTTAATTGGACCTGATCTGTATGGTGGTGACACTCCTGATGAAGATGACAATGCTGCCAGCTACTCCTCCACATCAGTTGTGCATAGGAAAGAAAAGACTTCCCAGCAGATAGCTGGAGAAAATTGCATGAGGCATTTGCTAGAAAGTTTAGATGGAGAGACTTATTCCTTCAGCCATGTTCTCCCCATGCTTAGTTATTTCCAAACAAGATCAATTAAACAAACTACCGTGTTCAGAGGTCCTCTGGAGATAGGATCACAGTTAAAGATCAATGTTTATGGATACAACAAGGTGAGAGAAGAGAAGTTAGCTTCCTGGAAGAAGCTTTCTGCTGTATCACAAGCATCTTCAAATCCTGATACAATGGAGGTACAGATGCAGAGGTCTTACCATTTAAATGATGATGATGACACTGAAGTAGAGAAGGAAAATGTTGCACAAGGTTATCGATATGGTAAAACATTAGTTCCATTAACAAAGATCGACAAAGACAGCATGAAACTCCCCACAGAACGATGCTTGTCAGTACTGTGCTTTGCATCAAATGATAATGTTTTGAGGTACCAGTACATAGGAGAAAATGTTATTGCTTTTGTTCCCCAGCCTGGAGACCAGCATGCAGCTTTAGCACTGTCAGCATTTATTAATGCAATGTATGAACTTAACACTGTTGCAATTGTAAGATATTGCCGTGCCAAAAATGCAGCCCCAAAGCTTGGTTTCTTGTCATCACATATCAAACAGGATTATGAGTGCCTTATGTTTACTGCACTACCCTTTTCAGAAGACATTCGGCAATTTGGATTTGCATCTTTTGATGCTAACAAGAAATGGATACCATCTGAAGAGCAACAGGATGCTGTGGATAGTCTCATAACTTCAATGGATTTAACAAATGCACAGAGAGATGAAGATGGCCAACCCATTGAAGCACTGAAATGTAAGACAACTTTTAATCCAGTGCGACAAAGAGTCTTTCAGTGCATCCAACATCGTGCTCTCAATCCTGATGACCATTCACTACCAGATTTGGATCCTGTCATTGCGAGCTATCTGGAACCAAGTACTGAATTCAAAGCCAGGTGTACTCCACAGTGTACCAAAGTAAAGGATATGTTCCGACTGGAGAAAGTTGAGGGCAAGAAAAAGGACATAGCTGCAGAAAATATCTTTGGCAAGATAGAAAATTCAAATAAGAATGGCAAAGTGCCAAGAAGCAGTGAAAATAGAGATGAAACTGACTTCAGCATGGCAAGTTTAGCAAGAGGAGAAGTCACTCAGGTTGGAACAGTTGATCCAGTCAGAGATTTCCATGTTATTATCAGTAAGAAGGATGAAGACAGATTTGATGAAGCAGCCAAGCAAATGAAAGAAAGAATTCTGCAGCTAGTTCTGGATTCATTCAGGGATCAGTTTTATCCTAAGGCTCTGGACTGTGTAAAAACTTTGAGAGAGGAGGCATTAAAGGCTGGTGAGTCTATGATGTTTAACACATTTATTCAAGAAACAAAAGAGAGACTAATAAACCAAAGAGGTCATGAATTCTGGCTGCTGATGGTAAAAGAAAATGTAAAAATGATCACTGAGGCAGAGGCTACTGATAGCACTGTAACTGAAACTCAAGCCGAAGAGTTTCTAGAATGTGGAAGTTCAAAGAAGGAAGAAGTTCCAGTTGATGAGGACATGGAGGATGCAGATGATCTGCTGGAGATGATGGAGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6DDS9	X-ray repair cross-complementing protein 5 OS=Xenopus laevis OX=8355 GN=xrcc5.L PE=1 SV=1
P27641	X-ray repair cross-complementing protein 5 OS=Mus musculus OX=10090 GN=Xrcc5 PE=1 SV=4
P13010	X-ray repair cross-complementing protein 5 OS=Homo sapiens OX=9606 GN=XRCC5 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003549 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08785 all species →	Ku_PK_bind	Ku C terminal domain like	Domain	Interproscan
PF02735 all species →	Ku	Ku70/Ku80 beta-barrel domain	Domain	Interproscan
PF03730 all species →	Ku_C	Ku70/Ku80 C-terminal arm	Family	Interproscan
PF03731 all species →	Ku_N	Ku70/Ku80 N-terminal alpha/beta domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR016194 all species →	Homologous_superfamily	SPOC-like, C-terminal domain superfamily	Interproscan
IPR036465 all species →	Homologous_superfamily	von Willebrand factor A-like domain superfamily	Interproscan
IPR024193 all species →	Family	Ku80	Interproscan
IPR036494 all species →	Homologous_superfamily	Ku, C-terminal domain superfamily	Interproscan
IPR014893 all species →	Domain	Ku, C-terminal	Interproscan
IPR006164 all species →	Domain	Ku70/Ku80 beta-barrel domain	Interproscan
IPR005160 all species →	Domain	Ku70/Ku80 C-terminal arm	Interproscan
IPR005161 all species →	Domain	Ku70/Ku80, N-terminal alpha/beta	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12604 all species →	KU AUTOANTIGEN DNA HELICASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000723 all species →	Biological Process	telomere maintenance	Interproscan
GO:0003690 all species →	Molecular Function	double-stranded DNA binding	Interproscan
GO:0006303 all species →	Biological Process	double-strand break repair via nonhomologous end joining	Interproscan
GO:0042162 all species →	Molecular Function	telomeric DNA binding	Interproscan
GO:0043564 all species →	Cellular Component	Ku70:Ku80 complex	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0003684 all species →	Molecular Function	damaged DNA binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006310 all species →	Biological Process	DNA recombination	Interproscan
GO:0003678 all species →	Molecular Function	DNA helicase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10885	XRCC5, KU80, G22P2; ATP-dependent DNA helicase 2 subunit 2	-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074606376.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

56TPM > 0

2Conditions

21.3Max TPM

6.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	30	5.63	18.02
all_coral_tissue · baseline	38	26	6.53	21.27

Per sample · hover a bar for the full sample record

Show the sample table (84 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.02
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.20
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.13
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.72
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.59
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.48
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.63
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.22
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.50
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.50
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.34
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.87
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.69
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.53
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.41
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.77
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.24
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.95
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.74
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.72
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.49
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.02
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.82
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.62
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.57
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.41
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.68
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.47
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.13
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.67
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.27
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.25
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.89
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.24
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.92
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.69
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.38
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.35
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.32
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.27
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.80
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.28
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.04
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.95
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.40
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.31
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.29
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.28
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.09
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.08
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.00
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.90
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.63
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.28
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.68
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.62
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora palmata tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	21	XP_074607450.1	0.81190758673646
Negatively correlated	3	XP_074613998.1	-0.544067886530386

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora palmata, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

DNA methylation (bisulphite samples)

Sample	Methylation profile
Polyp_Underside_Control_2	open
Polyp_Underside_Control_3	open
Polyp_Underside_Treatment_1	open
Polyp_Upperside_Control_1	open
Polyp_Upperside_Treatment_3	open
Polyp_Upperside_Treatment_4	open

The DNA Methylation page locates this gene by scanning the bisulphite table, which holds one row per cytosine. For the largest datasets that scan takes a while to return; it does not mean the link is broken.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →