Gene detail

Detailed information of XP_074606503.1 in Acropora palmata

Genomic Location: NC_133893.1:15223024...15251007
NR annotation: XP_015753331.1, PREDICTED: glutamate receptor 2-like isoform X1 [Acropora digitifera]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074606503.1

ATGGAGGGAAGAATAACTTATTTCTTGTTCTTGTTTACTGTCGGTCGAATTGTTGTACAGACAGTGTGCACTTCACAGAAAGTGTTCACCTGTGGCGTTATCAGTACAGATTCTGAATTTGATGCAATTACGTTCGCCCTCAACTACACTGCCCCCTTAAGCGATACTACAATAGATTTAAGAATTTTCAATCCAACAGAGCCAGGTAATGGCGTTTGCAAACAAGCTTTAGAACTTCTTCAACATAATGTGATTGCACTTGTTGAAGGGAGCCACACCAAGATTCCGGCATGTGCATTTTCTACAATCACCAACATTCCTCTTATCCATCTCCATGGTAACAATCCAACTCTGGAACGATGTGCTAAAGCTATTCAGCTGTCAGCGGATTGCAAGGACTACGCGCATGCTTCACTTGATATCATCAACACTTTTCACTGGAGAAATATAGCAATATTGGCTGATGAGGGTCGTTTCCAAGAAGCTGCTTCCATCTATGGAATATCCCAAGCTTCAAAGTTCACCTTGAGTCTACTCCAGCTTTCCGAGAAAGAAGTCACAAACGCCAGAAATAAAATCGGCAAAGCATCGATGCAACGTTTAGCGGAAAACATAGCAAACCTTGACCCAGAAGTCATTCTCCTCTACACCACTGAAGAAAAAATCCAACTTCTGATGACACAAACGATCCCCGGTAAAAGCAGAAATTATACAAGGTGGATCATACAAGGGCAGGTCAGACATAATTTCACTAGTCTCACAAACGATGTGGTCCTAGCGCTGAGACAGGCAATTTTGCCGAGGAAGGCATCTGGCAAGTTGGACCAACTTCTGCTGAAGCGGCTTGAGCAAATCGGGGACAAGGAAAATGTATTATCTGGTTGCGCAAGCTTCCGATACCTTTCAAGTTCTCCAAAAAGCCTTAGAAATAGAACCCCTTGCTCTTCAATAAATGCCTCAAAAGTGACAACAAAGGACAGAGAAAATCTGTTGGATTGCATAAAAAAGGTAAATCTGGACGGCATTACAGGGGAAGTACAATTTGACGAAAATGGACGACGAAACGGAATTCAACTGGAAATTCTGAATCTCCGAAACAATTCTTTTAAAAAGATAGGAAAATGGAACGCTGTTCAACGTGCTGTTTTCTACAATAGTGTTTTGCATAATATAGAGCAAGCTGGTCGAGGACGTTTGGATGGCTCGTTTCATAAAGTCGTCATTGCACTGTTTTTGATTGCAAATATTCTATGTAAATATGATGCCCCTTTCTTTAAAAATTTCCGACGTTCAAAGGCACAGACAAGACTCCCAGCCAACATTTGCGCAGAATCTACAGCGCAGATGAGAAGATTGCAGCCCATGCATTGCTCAATCTATTGGTACTTGTCATCCTTGCGAACTACTATACGACTATGGAGTGCGTGTGCATTATTTATCCTCAAAAAACGATCATCAGACGAAGAAAAGATATTTTATACTCAGTTTATGCAGCCATTTCACGACGACGTTTGGCTCGCAACATTTGCAACACTGGTGGTGATTTCTGTGTCTACCTTTGCTCTAAACTATTTTAGTCCATATGGACATAAAGATAAGAATGGGAAAGGAACATCGGAAGACTTTAGTTTCATCAATAGCGTGTGGTTTACATGGAGTTGTATGCTTCAGCAAGGTGTTGAAACCCAGCCCCGAAGCTTATCAGGTCGTATTCTTGCCGGCTGTTATTGGTTCTGTATCCTCATATGGGTATCAACCTACACCGCCAACTTGGCGGCCTTTTTCACGGTGAAAAACACCCAACACGGAATCAATAATCTTGAAGATGTCCTTCGCTCATCGTACAAAATAGGAATACGGGATCAAAGCAGTACCAGGGACTTCTTCGAGGCGAGTGAGTATGATCAGCATCGCAAGATCTGGCATCGAATTCAAACAAGTAACAACAAATTCAAAAGCACGCCTCAAGCCATACTGTGGGTCCGAGAGACGGAAGAGTCATTGTTCATATTTGATGGTCCAATTTTGAGATACGCGGCAAATCAGCCTCCATGTGATCTCGTATCAGTTCCAGGTCTCAGCACGGCCAGAGGCTATGGACTCGCTTTTCAAGCAGGTTCTCCAAACGTGAGTGAATTTTCCTTGGCTCTCTTACGACTGAATGAACAAGGTTTTCTTGGAAAATTGAAGAGAAAATGGTGGGATGATACTAACAACTGCCCGTTGGAACAAACAACAACTGCAGTGAAATCTTCCAAAATGGCTACCGACAATGAAAAAATCTCCCGCGCAGTGGATGAGACTTTGAAGGAGATAGAAAAGAGCGCTCCGGAAGAATTCGCTAAACTGAACGCCAATCAAGAGTTGAAGGATGCCATCATAAAGGAAGCTCGGAAATCAGCCAAAGAGGAGGTGAAATTGGCCCGGGAGTTCTCAGAACAGCCCGACATCCGTCAACGTCTGGCAAAGTACTTACCGGAGGAGAGAATCCAACTGATTGAAGAATCACTAAGCGTTCCAACATTTCGGGTTGAAATAACTAAAAAGCCAACTGGAAAATACTGGGTTGAGTTCACCAGAGAAGGCGAAGTTTTTCTTCCAGGGATAGAGATAGTGACCTCTGCTGACGTCGAAACAATAAGCATATTCCAAAAAGCCAGCATTGTTGTCGAGGCTGTGTTTCTTGTTATGCAAGTAGTTGGTATCAGAGTGTCGGTGAGCGAAAGCGCAATGAGGGCAACTGTGGAAGACACTGTCAGAGCAATCCAAAATTCCTCTCAAATGCAAAGGGCTATCCAAGCTTTCATCACCGCGTGGAACGAGGCAGGGGGCAGCGCGAGGAGGAAAGCTGTCGCTCTTTTTCACCTCCTTAAGGATACTTACGCCGCTGGTATCCTGTGGAGCACTATAAAGAGCCTGTGTAGTGAGATGACCACGGTGGATTGGTTGAAAACCGCTGCTCAAGTGTCCGCCATGCTCATCGCCGCGCTTGCTACAGATGGAGCAGCGCTGATCGCTAAGATTGCGCTCGTCGTTCTTGGCGCCCATGATTTCGCAAAGAAGCTGCTAAACTTGGCCCAACTTGAGGAGATAAATCAAACTCTGCAGGAAGAATCCAACCAAGAAAGCAGTAGCAGCGCAGCTTGCGTTTGCCAATAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P42262	Glutamate receptor 2 OS=Homo sapiens OX=9606 GN=GRIA2 PE=1 SV=3
P23819	Glutamate receptor 2 OS=Mus musculus OX=10090 GN=Gria2 PE=1 SV=3
P19491	Glutamate receptor 2 OS=Rattus norvegicus OX=10116 GN=Gria2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004471 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01094 all species →	ANF_receptor	Receptor family ligand binding region	Family	Interproscan
PF00060 all species →	Lig_chan	Ligand-gated ion channel	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR028082 all species →	Homologous_superfamily	Periplasmic binding protein-like I	Interproscan
IPR015683 all species →	Family	Ionotropic glutamate receptor	Interproscan
IPR001828 all species →	Domain	Receptor, ligand binding region	Interproscan
IPR001320 all species →	Domain	Ionotropic glutamate receptor, C-terminal	Interproscan
IPR001508 all species →	Family	Ionotropic glutamate receptor, metazoa	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18966 all species →	IONOTROPIC GLUTAMATE RECEPTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0008066 all species →	Molecular Function	glutamate receptor activity	Interproscan
GO:0015276 all species →	Molecular Function	ligand-gated monoatomic ion channel activity	Interproscan
GO:0035249 all species →	Biological Process	synaptic transmission, glutamatergic	Interproscan
GO:0038023 all species →	Molecular Function	signaling receptor activity	Interproscan
GO:0050804 all species →	Biological Process	modulation of chemical synaptic transmission	Interproscan
GO:0098839 all species →	Cellular Component	postsynaptic density membrane	Interproscan
GO:1904315 all species →	Molecular Function	transmitter-gated monoatomic ion channel activity involved in regulation of postsynaptic membrane potential	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0005216 all species →	Molecular Function	monoatomic ion channel activity	Interproscan
GO:0006811 all species →	Biological Process	monoatomic ion transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074606503.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074606503.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

73TPM > 0

2Conditions

141.3Max TPM

17.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	38	12.47	40.75
all_coral_tissue · baseline	38	35	24.57	141.27

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.75
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.01
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.16
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.20
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.96
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.08
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.41
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.24
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.21
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.04
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.66
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.93
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.29
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.69
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.11
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.21
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.01
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.38
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.59
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.16
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.63
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.25
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.10
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.31
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.13
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.03
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.78
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.74
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.73
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.94
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.55
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.46
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.33
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.08
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.80
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.96
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.68
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.95
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	141.27
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	98.58
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	66.29
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.20
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.94
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.83
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.50
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.42
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.89
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.86
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.47
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.49
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.16
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.17
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.89
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.99
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.17
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.44
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.21
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.80
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.66
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.30
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.06
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.29
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.92
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.43
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.86
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.21
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.81
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.79
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.98
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.27
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.53
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.95
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.