Gene detail

Detailed information of XP_074606559.1 in Acropora palmata

Genomic Location: NC_133893.1:6682019...6693645
NR annotation: XP_029204094.2, glutamine-dependent NAD(+) synthetase-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074606559.1

ATGGGAAGAAAGGTCACTCTTGCGACCAGCAGTTTAAATCAGTGGGCCTTAGATTTTGAGGGAAACTTGAAAAGAATTCTTCAAAGTATAACCATAGCGAAAGCACATGGCGCTTCTTACAGACTCGGCCCAGAGCTCGAAATTCCAGGATACGGCTGCAACGACCACTTTTTGGAGAGCGACACGCTGCTGCATTCTTTCCAAGTTCTTGCGTTGTTGTTAAAATCACCCATCACCAAAGATATGATCTGTGATGTTGGGATGCCTGTTATGCACAGAAACGTTCGATACAACTGTAGAGTTATTTTCCTCAATAGCAAAATACTGCTTATTCGACCAAAAATGACTCTGGCTTGTGATGCTAACTACAGAGAAGGGCGATGGTTTACAAAGTGGACGAAGGCAAAACAAACAGAAGAGTACTTCCTTCCACGCATGATTTCAGAAATAACAGGACAGGTAACTGTTCCATTTGGAGATGGTGTCATCTCCACACTGGATACCTGTATTGGAACAGAAATCTGTGAGGAAATATTTAGCGTGAATGGCCCTCATATTGATATGGTGCTTGACGGTGTGGAAATAATCACAAATGGCAGTGCGAGCCATCATCAGTTGAGGAAGCTAAATACCAGAGTTGACTATGTCAAGGATGCCACCATCAAGGGGGGTGGAATTTATATGTATGCTAATCTCCGAGGCTGTGATGGAGAGAGAATCTACTATGACGGATGTCCCATGATTGCCGTCAATGGTGAAATAGTTGCACAGGGTGCCCAATTTTCACTCAAAGAAGTTGAAGTTGTCACGGCAACTGTCGACCTGGAAGAGGTGAGGTCTCATCGTGGTGCCACGCCAACATTTGGTTCATGTGCAACAGCTATTCATCAAACTTTTCCACGCGTTAAAGTTGACTTTGCGCTAAGCCATGAAGATGACATAACCATCCCTTCAGCAGACGCAATTGATGTCCATTATCACACACCGGAGGAGGAGATAAGCCTTGGTCCCGCGTGTTGGTTATGGGATTATCTCAGAAGAAGTGGTCAAGCAGGGTTTTTTTTACCACTTAGTGGAGGAATTGACAGCTCTTCAACTGCGTGCATTGTGAGTTCCATGTGTCACCAAGTTTGTCAAGCTGTGAAGAACGGGGACCAGCAAGTTTTAGAAGATGTTAGAAGAATCGTCAATGATAATGCTTACATTCCGACAGATCCCAAAGAGCTTGGAAACCGTGTTTTTGTCACGTGTTACATGGGGACAGAGAATTCTTCGGAAGAAACCAAGAAAAGAGCAAGTGATCTTGCAGAAGAGATTGGGAGCTACCATATGGGAATCACAATAGACGCTGCTGTTAGTGCTGTCCTCGGCATTTTCACTGCAGTTACGGGTAAAATCCCGAAGTTCAAGTTACACGGCGGTACGCATCGGGAAAATCTAGCCATGCAAAATGTTCAGGCACGACTGCGCATGGTCTTGGCTTACTTGTTCGCTCAGCTGATCATGTGGGCGCGTGGGCTACCTGGAGGATTGCTGGTGTTGGGTTCAGCAAATGTGGATGAGAGTTTATGTGGATATCTGACGAAGTACGACTGCTCAAGCGCGGACATTAATCCTATTGGTGGAATAAGCAAGAAAGATTTGAAAGCCTTCATATTTTATTGCGTGGAAAAGTTTAACTTCAGCTCGCTGATAAGAATTCTTGGTGCTCCGCCAACGGCCGAGTTAGAGCCGCTTGCTGATGGACAAATTCAGCAGACAGACGAGGAGGATATGGGAATGACGTATGACGAGCTGTCCATGTTTGGTCGTCTGAGAAAGGTTTCTCGTTGTGGTCCCTACAGTATGTTCTGCAAACTGGTTCACTCCTGGCGAGGCAAGTACGCGCCTGTAAACGTGGCAGAGAAAGTCAAACGCTTCTTTCGAGCGTACTCCGTTAATCGTCACAAAATGACGACACTAACCCCCGCTTATCACGCCGAGAATTACTCTCCCGACGACAATCGATTCGATCATCGTCCATTCCTTTATAACATTCATTGGCCGTGGCAAATGCGACTGATTGACGACGAAATCCGACGACTTCAACAAGCGGCCGAGACTTCGCAGTTACGCCATCAACAGTCTCATCTTCATGCTAACGACGATACCGTATTTGGTAGTTTACAGGATCATATCGGTGGAAGCGACGGTTTGACGTCGCTTGTTTCGACGAAAAACGAGCGGTCCGGAAGTCAATCGTGTTCCGAAGAGCTTGTGCACCAGACAAGACGAGACAGACTGGAGAGAACTGTCGAGACACTGTCGAATTTCAACCGGGGGAGTCTAAGGGCGCAGAGCAGAGGAACACCTCCATGTCCAGCCCTCATTCGTATTAAATCAGAACCCGCAGATTTTAGTGATGGCTGCAATTCACTCGTGAACGCGCACGGGGACACGGGTCGGATGTCACGCAAAAGACGAGAGTCACACGCAACAGGGCATGCGCAAGATGGAGACCAAGCGAGCGGGGAAAAACACATGCGCATGACGTCCTTGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5ZMA6	Glutamine-dependent NAD(+) synthetase OS=Gallus gallus OX=9031 GN=NADSYN1 PE=2 SV=1
Q711T7	Glutamine-dependent NAD(+) synthetase OS=Mus musculus OX=10090 GN=Nadsyn1 PE=1 SV=1
Q3ZBF0	Glutamine-dependent NAD(+) synthetase OS=Bos taurus OX=9913 GN=NADSYN1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005030 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00795 all species →	CN_hydrolase	Carbon-nitrogen hydrolase	Family	Interproscan
PF02540 all species →	NAD_synthase	NAD synthase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR003010 all species →	Domain	Carbon-nitrogen hydrolase	Interproscan
IPR022310 all species →	Domain	NAD/GMP synthase	Interproscan
IPR003694 all species →	Family	NAD(+) synthetase	Interproscan
IPR036526 all species →	Homologous_superfamily	Carbon-nitrogen hydrolase superfamily	Interproscan
IPR014445 all species →	Family	Glutamine-dependent NAD(+) synthetase	Interproscan
IPR014729 all species →	Homologous_superfamily	Rossmann-like alpha/beta/alpha sandwich fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23090 all species →	NH 3 /GLUTAMINE-DEPENDENT NAD + SYNTHETASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006807 all species →	Biological Process	obsolete nitrogen compound metabolic process	Interproscan
GO:0003952 all species →	Molecular Function	NAD+ synthase (glutamine-hydrolyzing) activity	Interproscan
GO:0004359 all species →	Molecular Function	glutaminase activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0009435 all species →	Biological Process	NAD biosynthetic process	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01950	E6.3.5.1, NADSYN1, QNS1, nadE; NAD+ synthase (glutamine-hydrolysing)	EC:6.3.5.1	Nicotinate and nicotinamide metabolism	ko00760	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074606559.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

65TPM > 0

2Conditions

24.4Max TPM

10.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	35	9.19	24.41
all_coral_tissue · baseline	38	30	11.97	21.38

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.41
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.17
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.19
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.16
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.92
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.87
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.13
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.96
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.96
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.82
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.79
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.60
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.51
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.28
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.13
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.93
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.58
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.10
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.67
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.60
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.27
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.24
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.18
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.04
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.86
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.78
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.23
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.54
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.51
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.28
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.10
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.82
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.73
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.60
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.58
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.38
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.20
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.58
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.54
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.51
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.50
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.32
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.92
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.29
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.87
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.65
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.40
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.95
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.71
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.56
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.54
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.95
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.89
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.38
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.00
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.66
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.47
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.06
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.97
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.38
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.10
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.93
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.71
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.65
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.64
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.