Gene detail

Detailed information of XP_074606754.1 in Acropora palmata

Genomic Location: NC_133893.1:14085343...14115862
NR annotation: XP_044181092.1, LOW QUALITY PROTEIN: extracellular sulfatase Sulf-2-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074606754.1

ATGGTATCTCGTTGTGCTTGGACGTCTACTGATCAACAGGCAGTCAAGCGTTTCGGAACGGCGATGAGTCGACAAGAAACAGCCAGTCACGTCAAAAAGACTTCAACATTTGCAGCCTTGCTGTTTCTGCTGCTACAATGTGGTTCGACTCTGGGTGTACGCAAATCGAAGGCGAATCAACAAAGTGGGAGCAGATCTATCAAACGTCCCAACGTTATCTTCATACTCCTTGATGACATGGACAAAGAACTTGGATCTGCAAACGTGATGACAAAAACACAACGACTTATACGTGAAGAGGGAGCTGAGTTTGTCAATGCATTTGTCACAACTCCAACCTGTTGTCCATCCCGAACGAGTATTTTGACAGGAAAGTATGCTCACAACCATCACACGAACACGAATAACTGGAATTGCTCGTCACCCTCTTGGAGAAAAGGCCCCGAAAAGAAAACATACGCGAGGTACATGGAGTTGGCAGGATACGTTACCGGCCATTTTGGGAAATACCTGAACGAGTACGATGGGACATGGGTGCCTCTTGGTTGGAAAAAATGGGAAGGGCTCCTGCATAATTCCAAATTTTACAACTACACGCTAAGACACAACAACCACAAAGAGCGACATAAGATGAGTTACGAGACAGATTACTTCACGGACCTTATCACCAATCGCAGTATTTCATTCATAAAACAGACAGTAGCAGCCAATCCCAACAGTCCTTTTCTTGCAGTTTTGAGTCATTCTGCTCCTCATGGCCCAGAAACGCCTGCTCCACAGTATAGCACGGCTTTCCCAAATGCCAAAGCTCCACGGCTTCCCAACTGGAATTTCGTTTCGCCCGATAAACAATGGATCCTCAGGCGGAAAGAAAAAATGGACGCTCAGAAAATGGACTTTGTGGATCTCTTGCATCGTCGCCGACTTCAGACGCTTCTCAGCGTTGACGACTCTGTAGCTAAGATCTTCCACACTCTTCAATCACTAGGCATTGAAAATGAAACTTATATCTTCTTCACCTCAGACCACGGCTATCATCTTGGGCAGTTCGCCTTGGTGAAAGGCAAATCTATGCCTTTTGAAGCTGATATAAGAGTGCCCTTCTATGTTAGAGGACCGAGCATCCCGAAAAATATCAGGATAAAAGAGATGATTGCAAACATCGACATCGCGCCATCGTTTTTAGACATCGCTGGCGTGAGCACTCCACGTGACATGGACGGCGTTTCAATCATGAAACTCTTTAGGAAGTCAAAAGATGGTCGAAGATACAAGAAGAAAGAGCATGTGCAATGGAGAGACACAATTCTTATTGAAAGGTCTAGAGGCTGGCGGAAGAAAAGAAGCAATTGGTACGAAAGTTCACGCAATAAAACAGGTGGACGCAAAGACAACAAGGTGTTAACCTCGAGGAATGGTAAACAGATAACCAAAGACCGCAAAACGACATTGTTGGCGACGATCTGCGCCGCACGGAAACATCAATCGCCGTGCCAGCCAAAGCAACTGTGGGAATGCGTGATAGTGGACGGAAGATATAGACTGAGGAAATGCAGAAAAATTGGACCTACTACCCCTGCCCCACCCACCCCATCTGTTGCTCATACCACCCCTATGAAGATGTGTGTCTGCGTGAAACAGGGGCTGGAGCAAGAGGATCAAGGCAAAGTGTATGAAGAACAACTAACGGAAGAGTTTGGCAATCGTGCGTCATGGGAACTAAAACGTCGAACAAAGCGAGCTGGCTTCGGTGAGAGGCAAAAAAAGAACAGAAACGAATTAAATCCGAGAAGGTATAGCAAAGAGTTAGCGAGAATACAGAAACTTCAAAATCGACGAGCAAAATCAAAGATGATGCTTTCAGGAAGAGTGACAGGAACGAAAAGGAAATCGAACACAAGCGAATCAGTTGATGATCATTTCACTTATCCTGGTGTCGTTGAGGAGAAACTTGGAAAACTAAAGGAAAAAATCTGGGAAACCAAGATGCGGCTAGAGGCATTGAGAGACCGCAGAAAGAAACTTCTGATGATAAGCACCCGCGATCGGCCTATCGAATATCTGTGTCCTTGTTCCCCTGGCAACAGCAGCAGTATTCGTAATGGTGCTCAGGAGTTTGGGTACGATAACGACAACAAAGGGTCACAATTGTTAACTCCCAAAAGACGAAATAAGGTTTCACGCAAACACGAGCTGAAGAAGAAAAAAGTAAAGACAAGTTTACGACGCAGTAAATGCAGCAGTCCAGGCGTAAATTGCTTTTATCAGACAAATTATCATTGGAAATTACCGCCCTTGTGGACAGGAGGGGATTTCTGTTTCTGTCCAAACGCGGCCAACAATTCCTACTGGTGCTTGCGAACAATAAATACCACGCACAACTTCCTCTACTGTGAGTTTGTTACTCATTTCTTGGAATTCTTTGATATCAACCAAGACCCATACCAGTTGTACAATGTAATTCATGAGGTAGAGCCTGCAGTTTTATCGCAGTTACATGAACAGCTGAACAGGATGAGAGTTTGCAGAGGACAAGGCTGCACTCATTACTACGGAAAGAAGTATCCTAATGAGAACACAGAGTCAGTACCACTAACATCTTCTCTGTCTTCAACTCCATGGACAAGAACAGTTAACAACGAAAATAGTGCTGCTGTCAACATAAAAAACATAAGCAAGCCATCAGCATCGACGCCGGGTCATTCGGAACGAGTCGAAGATCGGTCGGCAACTTTCGTAAGTACTCCGAAAATGCCTAGTAATGTATCGAATACGGCCGAATCCTCGACGAGTTCATTTGTCACACCACCGCACATTACAGAAGGAAAAGGCCCGGAAGAAGATTGTACCAAAATACCATTCACTTCTTCAAAAACTGTTTCTTATACAAGAAGTGAGGCCGAGAATATTCTTACGAATGATGTCGAGGGATCCAAAGGAAGTGTAGCAGAAACTGCGAATCGCCCCGGAGATAAGACGAAAGTTTTCGTAACGACCTCGGCGCTTGAGTCAAGTTCTTCAGTCACCGCGTCTTCGACTGAAGCACCAACGACCTCAAAGTTTGACGCGATCACTCTCGGCGAATATTCAACGGCGAAACCAGCGCGTCGAAAATCCACAAAACGACGAAAGAATGGGGGAAAAGAAGGAAAACATGCTTCAAAAAATTCGAAGAAATCGAAAAAAAATAAGAAGAAGTCAGTGGGAAAAGGTACATCGCAGGTGTCCACAAAGACTGATTCTTCAAGTGAAAACGAAAACACCTTTCAGCCTCTCAAAAATCAAGAGAAGAAGTCGGAAACAAGAAAGCCAGGATTGAAAGTAATCAACAAAGGTGACAATAAATTGTCACCGAAAAACTCCCGAAAGCGAAATAAAAAGCCGTCAGAAAAAAAGCTCGAAAAAAATATTAAGAAGCGAGGGAAGAAGCAACCAACCGCAGAAATAAACCCTGGAGGGGTGGGTGAGGACGAAACCACTGCGTCTCCTTTGTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q21376	Putative extracellular sulfatase Sulf-1 homolog OS=Caenorhabditis elegans OX=6239 GN=sul-1 PE=3 SV=1
Q8CFG0	Extracellular sulfatase Sulf-2 OS=Mus musculus OX=10090 GN=Sulf2 PE=1 SV=2
Q90XB6	Extracellular sulfatase Sulf-1 OS=Coturnix coturnix OX=9091 GN=SULF1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002010 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00884 all species →	Sulfatase	Sulfatase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR017850 all species →	Homologous_superfamily	Alkaline-phosphatase-like, core domain superfamily	Interproscan
IPR024607 all species →	Conserved_site	Sulfatase, conserved site	Interproscan
IPR000917 all species →	Domain	Sulfatase, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43108 all species →	N-ACETYLGLUCOSAMINE-6-SULFATASE FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005539 all species →	Molecular Function	glycosaminoglycan binding	Interproscan
GO:0008449 all species →	Molecular Function	N-acetylglucosamine-6-sulfatase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14607	SULF; extracellular sulfatase Sulf	EC:3.1.6.-	Enzymes with EC numbers	-	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074606754.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

75TPM > 0

2Conditions

107.5Max TPM

24.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	42	25.73	107.51
all_coral_tissue · baseline	38	33	22.13	75.91

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	107.51
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	77.34
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	53.47
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.22
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.15
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.67
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.14
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.11
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.66
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.47
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.21
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.68
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.41
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.82
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.63
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.11
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.59
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.69
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.57
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.89
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.08
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.14
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.79
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.23
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.29
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.58
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.53
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.53
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.07
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.13
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.96
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.73
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.43
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.02
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.68
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.15
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.00
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.55
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.32
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.99
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.79
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.38
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	75.91
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.46
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.85
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.74
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.56
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.43
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.60
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.82
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.47
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.37
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.16
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.34
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.92
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.92
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.21
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.14
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.10
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.65
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.33
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.20
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.20
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.16
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.08
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.43
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.46
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.72
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.29
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.04
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.75
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.27
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.96
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.75
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.62
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.