Gene detail

Detailed information of XP_074606965.1 in Acropora palmata

Genomic Location: NC_133882.1:28093820...28112562
NR annotation: XP_029182501.2, hamartin-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074606965.1

ATGGCCTCGACAACGGAGAGTTCCTCTCCTTCGAATCAGCGAGACTTGTTCAGCCTGCTAGATGCAGATAACATTGAGACAGCAGAGGAAACGAAAGCCTTGATACTCGAAAATCTTCACTCATCCCGTGACCCAGGATTGCTGAATTCCATGGTGGAATACTATTTGAAAACACGCTCAGCAACATGTCTGCAGATATTGACTGGAATCCACGAGGCTCGAGGACAGGCGCTGTTTGAAAAAATGAATGAGTCGCTGAAACACAGAACGACCCGTTTGGACACTTTAACGCTCCTGGGTCATATCGTTCGGAAACAGCCATCCTGGTTACATAAAATTGTGAAGACTCCACTCTTTGATGCTGTTCTCAAGCATATGAAGGCTGACACTGATGTGGTAGTTTTAACAAGCGCTGTTTTGACTATTACCACCATGTTGCCATTAATACCTGCCTATGTTGGTCCTTGGCTGCCCGAGTTGTTTGACATTTTTGTCAGATTGTCGTCATTCAGAGCACATAGTGAGGTAAATCCTCCTGAAGTGCATCTTCTGCATCTCCATGTTGCGGTGTACATGTTTTTTCACCGACTGTATGCCATGTACCCAAACAACTTCTTGATGTATCTTAGAAACCTTCACAATGAACCATCTAAACGAAGCTTATTTCAAGACATTATTAAACCCATGCTGGAGAATGTACGAGTTCATCCTTGTGTCGTGACAGAGACAGAGCAAACAGAAACGAATAAGCACAGGTGGAAACAGAAAGAACCACATGACATTGTTGTGGAATGCATGAAAGTGTCATTAGATCCTATTGACAGAATACAAGAGGAGGGAAATTTCATGTCCTCATCAACCTACAGGCAAAGTCGTCAAGAAATGTTTGCTGATAAATCTGTTACCTCCATCCTCACTGCATCTTGCGACAGTGAGGGCTTTGGAATGGAAAAACTAAAGGAGCGCCGAATGTCCGATTCAGCGACGCAGACTGGCAAGTCCTTGCAGAGTGGTGACAGTGGTACGGATTGCTGTAGTCTGCCTGTTGTTTCTTCAACTGAGATTACAGCTGGGTGGAGTCCATCAGAGTTCTGTCAACTGAGTACTCCCCCTTCTTCTCAGATGTCACCGTCGACAAGCAATCCTGATTTGATGTCATCTCTTAACTTCCTCTCCCACTGTAGTACACCTGCTGGCGTGTACACACCAGGACAGTCCCCCACGGCATCTCTTGGAGGCGATGAATTACAAGCACAAGGCTACTCCAGTTCATCATCTTTTTCAGGAAGTCGAGGAAAAGATAAGGGAATGACAGGGATGTTAAGTGACCAGGTGATTTCACCCAGGAGTGAGAAGACTGTTGGTCATGATGGGCTGCTAGCAAGGGCCTTGATTTCGGCACTGGCCTTGCAAAGTCCCAAATCAAACCATGGACACCAGACATCAACACCAAAAGAACAACTGAAATGCCAGGAAGTTGATGAAATAGAAAGTGAGATGGCAGTAAACCATGGCACACATGATGTCTCGCCCAAGAGTCCTTCTACAAGTTTCAAGGCCTGTGGTAAAGAAACAGACTGTGACGTTGTCAAAACTAGCACAGAGAAATTTGATCATAGTAGTTTGAATGTATTACAAAAAAAGGAGTTTAGAGACTTGGACAAGGAAGGGGATGGTTGTCTTGAAATGAGTAAATTAAAGGCTGCAGGCTCAAGGCCTTTTAGTGAAAATCGGGACGTTTTGGCACAGTCCCAAGCAGTAGTTGGTGATCAAGCTTTTGGCGAGACACACCTACTGGACGAATCTAAACTGTCATCAGAAAGTACTTGTTCAACAACAGAAGTAAATGGATCTCTAGATGCAACAATGGAATCTGAATTTGATAGTGATGGCTTGGTTAATAGAAGTCAATTTAATGACCATGCTCAGGGAAATGTACAAGTCGAGACAAACAAAAGTGAAACTAGCACAGCATCTGGTGATGCGCCAACTGACTTTTCAAAATGTAATACAACGAGCTCTGCCTCGCAGGTGAACCATCATGCTTCTTTTTCAAGGGAGCTCATTGCGGCCTTTCCGCAACTGCTGCATCTAATGAAAGGTTATCAGGAATGCAATCATTTCAATGCGTGTAATGATGAACCGAGCTTCTCCAGACCTCAGTCACATGAATTGTCATGCAGAGCTAGTCCAGTAGAAATACTTGATAGCTTCCTTAAAACAGGAACCAGTGTACACCACGGGGAACTTTCAAGAGTCCCTCTTGTTAGCCAAGCTGGGGCAACTTGGACACATTTTGGAGGTGAACCTCCTGCAGATGAAGTTGAAATCCTGCGAGGCCAGGTGAAATTATTGCATAACCAGTTGTTGTTTGAGCGACACAAGTGTGATCTGCATGCTATTCGTAACAGAAGGCTCATTGGCAAGACATTCAAGGCTGTGCAACATCAGGAAGAGTTACAAGCCACTAAAGACCAGCTGAGGCTGCAGGAAGACAAAATGAGAGAATTAAGTGATGCCTTAAACAAACAGATGGAAGAAAGCAGGAAATTTAAATCTGTTACCTCTGGCTGGGAAAATCATCAAGGGATTGAACTACGGAATTTGCAGAATGAGAATGCCAAGCTCAAGGACATTGAGAAGGAACTCCTGGAAAAACTTGAAACTCAGAAGAAAGAGTGTGATTTAAAACACACAGAAGTTCAGCAGCTGAAAGCAAAAATCTTTACATTGGAGAATGAGCTGGATCGACTTAAAGTTGAATCTACAGAAAAAGATCAGTTGAAGATACAGGTAAATCATCTTGTCAAGGAGGTGCTTTTGATGGGTGAGCTGAATCAACAGCATAAGGATGTTATCAAAAAGTTAGCTGTTGCAGAGACTCAGAACCCTGAAAGCTCAATGCAATTACAAAGCTGCCTAAAAGAATTGTCAGCTGCTAAGCAGACAATGAAAAAGCAGACAGCTGAAGTAGAAGCTTTGACGTCGAAACTTGCTGATATGGAGACACTGGTTTCCAGCAAGGATGGTGAAATTAGAGATATGAAAAAGTTTGTGGAGGGGTTGAAAGGAACATTTAGTGGGAAGATACAGGGGTTTTTAAGTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Z136	Hamartin OS=Rattus norvegicus OX=10116 GN=Tsc1 PE=1 SV=1
Q92574	Hamartin OS=Homo sapiens OX=9606 GN=TSC1 PE=1 SV=2
Q9EP53	Hamartin OS=Mus musculus OX=10090 GN=Tsc1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004696 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04388 all species →	Hamartin	Hamartin protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR007483 all species →	Family	Hamartin	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15154 all species →	HAMARTIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008285 all species →	Biological Process	negative regulation of cell population proliferation	Interproscan
GO:0032007 all species →	Biological Process	negative regulation of TOR signaling	Interproscan
GO:0033596 all species →	Cellular Component	TSC1-TSC2 complex	Interproscan
GO:0051726 all species →	Biological Process	regulation of cell cycle	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K07206	TSC1; tuberous sclerosis 1	-	Human papillomavirus infection	ko05165	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074606965.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

76TPM > 0

2Conditions

51.6Max TPM

30.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	42	29.28	51.60
all_coral_tissue · baseline	38	34	32.05	49.62

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.60
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.42
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.51
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.88
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.55
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.45
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.15
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.22
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.07
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.95
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.87
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.96
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.97
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.99
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.70
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.36
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.54
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.49
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.24
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.89
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.09
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.88
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.31
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.44
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.68
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.29
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.18
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.05
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.04
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.59
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.52
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.25
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.16
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.73
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.45
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.47
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.15
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.46
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.25
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.76
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.22
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.12
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.62
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.50
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.90
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.31
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.64
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.80
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.35
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.11
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.88
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.52
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.85
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.75
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.32
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.91
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.91
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.87
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.91
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.57
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.40
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.71
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.64
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.13
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.72
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.21
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.76
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.04
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.67
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.59
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.36
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.97
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.59
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.19
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.24
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.