Gene detail

Detailed information of XP_074606975.1 in Acropora palmata

Genomic Location: NC_133882.1:27972748...27980790
NR annotation: XP_044175835.1, probable ATP-dependent helicase PF08_0048 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074606975.1

ATGACCTCTGAAGTCCGCACTTTCCGAGTGGAGAAGAGGCCAGCAGTGGGAGTGAAAGAAGAGAAGGCTTCTTGTATCGAATGCACGTCTGGACACTTTGAAAGAGAGCTGTGGTTGCAGACTATTGAGTCAAATTCGGATAACTCCGACATGTACAAAAGTAAGCAGCAACACGCCAAGGATGGACAAAAAACAAAACTGCAAGGGTATCGGGTTGCCACGAGTCGCACGAAGATCATGCCTTCGGTTACCGTCAAGAAAGAACGAGACGAAGAGTTCGACCACAATGCGGGGCACAAGAGCGGCACACCAGCGTCCTCATTCGAAGAAATCACCACCAAAAACCATGAAACGATAGCTAACAAGCTCGATGAGGATTCGAATCTGGACAATATGAAAAAAGAAGACTTCAAATACTTGTCTCGTCCCGAGAGTCAATCCCACCCAGAGAGTCCAACCAGTCCCGAGAAAAGAGCATTTTCCCAGTCCTCACCGCGCGATTCCGAGACTCTCTTTCTTCCATGGCAACCAATGGAACAATTAAAGGATAGCGCCTTTGGGGTAAAGAAGAACCCACCCTACCCTCGCACCAGTTATCTTTGTTTCCCTGGCAAACGTACACACTGTCGGGTTCTACCTCCAAACTCTGTTGAAAGTACACCTAAAAGCCACATTCTGGAACAGTATTTCGGAAAAGATGCAAAAGCAGATTCGATCGGATACGGTCAAGAACGATTTTGCCAACACGAAGAAAACGTCGGATTCTCTTCGATTTACGACGACGAAAACGAATACAGCGACGGCCGCATCAAAGATCGTTTAGGTTCCAAGCCTCGTAAAAAAAGTCTATCGCCGACAGAGAAAGCCGAGCAAAATGAGTGTACTCAGACGAAGGATGAGAATATAAGCCAAGATGTGAACACGAAAGACGAGGAACCAGTTTGGAAAAAATACCAATGGTACAGAGATAGGAAACGACCTTACTCTCTTCAGATCAAACGCCATAACGCAGAACAACCTGTATTCAAGCAATACAACGACATCCGTGACAAACGATTTAAGGAGGGGAAGGTGGTGATCGACAAAAGAAGAGTCTCAGAACCCTGGAACTTTCCTGAAGAAAACAGAAAAGCTTGTCCACCTTCTTTCAACAGAGCTTCCTATAGATTCATTTCTCACACTGATGCCGTTGAGCCAATCAAGCGAAGAAAAATCTCACACGGCTCAGAACTCTCGGGCGATGGAGGATATTTCCATGACAACGAAACCGCTGATCAGGATGCCTTTAGAAAAGAGCATATTGCTTTTCACTATAACTTTGAAGGTGAAGCTCTCAACAGCACAGACGAATACTGCAACTTTGATAAACGCAACGCTGTCCAGAGTGGATTGTGTCCTTCCGATGAAAAGGCTACGAATACTTGTAAAACTACAATAAATAGTGATTCAGGCGTTTCTCTCAATAATGATGACGATGACATTGATGATGACGCTAATGATGATAATGACGATTACAACGCAGTTTTTGAAGAGAAAGTAGACGTTCGTCCGGGCGCTCTACGTCACTATCCCCAAGACGTGGCCAAGATTCTACGGCTCAACCGAATCGTAAAGGCGGTCCGAAGCAACTCAGTAGAACGAAAAACAGTCGAGAAAATGAAAAGAACACAACCAACATCTCCTCGGGACGAGGACAAAAAGAGCGTAGCCAGCGAAACCTTGGAACATCGGGGATTAGAAAATGGACCCGCGGGAATAACTGACGAAAGAGCCGAGAGCACAAGTGAGACACCCAATGATTTTTCCTATCCTGAAGATGACGAAAGATTTGTGAAGAACAGAAACAAAAAACTTGTCGAGGGCAGACAGGACTTTCCTAGCTTAGCGCAATCTCCTTTTGATGAAAAACCGGCGGATGCGGAGCAGGTGAACGTTCAAAATGACGATGATCCTGTTTGTCAAGTAAACGGACTGCTGTCTCTTCCTGGATTAAAAGAAACCAAGTTTAGCATCAGTTTGGGAGAACTCAAGCGAAGAATGAATCCACCTGAGACACTGACAAGAGTGGAGATGATTTCATATGTGCGACAGGCAAAGTCAGCGGGTCGGACTCTCCTTGATAGCCACAACATCGTCACGGCCAACCGGTCCCACCCCACAGTCCTCTCGCGCGTGTGCGAAAGCGAGGCTCAGGTGTTGGCTGACGGGATTCTTAAAATGAACAAGGAGTACATGCCCATGGCTTTCTTGGCGCGCAAAACAGTGAACGCTTACAAAGACGACGGCTGTAGAGTTGACAACTGTGAAGACTGCAGGCTAAAACTGAGAAGACGGATTGTGGATGTTGAGATAACAAGAAATTCTCTGAAAGAGCTGCAGAAAGTTATTGAACAAACAAAGAAAGAACCCGCCTTCGAGACATTTGACCTCGCTTCTCACACATTTGGAGTTTCAAACATTCGCAACCATTTGACTTTGCTTGATGATTATTTTAGACTTCTTTTGTTGACACTACAAGATGAGTAA

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002734 (this species only)
Transcription factor family	AP-2 · all TF in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03299 all species →	TF_AP-2	Transcription factor AP-2	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013854 all species →	Domain	Transcription factor AP-2, C-terminal	Interproscan

PANTHER

No PANTHER signature was detected for XP_074606975.1. This gene does have a gene model — the search simply returned no hit.

Gene Ontology

No Gene Ontology signature was detected for XP_074606975.1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074606975.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074606975.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

60TPM > 0

2Conditions

31.9Max TPM

9.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	30	4.35	18.09
all_coral_tissue · baseline	38	30	15.96	31.85

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.09
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.44
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.13
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.06
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.26
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.15
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.34
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.32
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.15
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.98
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.86
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.23
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.04
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.90
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.86
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.70
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.18
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.46
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.76
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.61
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.59
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.34
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.06
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.04
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.94
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.94
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.63
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.59
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.81
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.63
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.85
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.55
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.93
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.71
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.10
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.52
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.45
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.78
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.63
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.17
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.13
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.57
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.29
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.65
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.94
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.52
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.45
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.27
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.04
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.18
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.97
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.31
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.85
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.42
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.06
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.75
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.57
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.52
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.45
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.86
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.