Gene detail

Detailed information of XP_074606987.1 in Acropora palmata

Genomic Location: NC_133882.1:28213699...28244523
NR annotation: XP_044175762.1, Na(+)/H(+) exchanger beta-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074606987.1

ATGTCTCTTAAAAGTCGCTCAGCCTTGTTTTTAGTTGCGGGCGTCTTCATTTGCCGTATCATCGGAGCCACTAGTGCGAGTGAATCACATTCACAGCAGTCGGGGAATAATTCTAACCACGAAGATCCACCTCCGCTCAAAGTTGCTAAATTTGATTTTGAGCGTGTCTCAGGGCCTTTGATCATCATTGTGTGGATTTTAATCGCAAGCCTTGCAAAATTAGGTTTTCATTTATCTCATAAGTTGTCTTCAGTAGTACCGGAATCATGTCTTGTAATTCTACTGGGAATAGTTATTGGTGGAATCATGAAGGGAATTGGGGCAGAAATTCCAAACTTCACATCAGACACTTTCTTTCTCTTTATGTTACCACCTATTGTTCTTGAAGCTGGCTACTTTCTCCAAGATCGAGCATTTTTTGACAACATTGGAACAATATTGCTCTATGCTGTTGTAGGAACAATCTTCAATACTTTCACAGTGGGGCTCTCTCTGTTTGGAATAAGTGGCAGGCTTGGAATCAATATACCTGTTATGCATGCCTTGACATTTGCTTCACTCATTGCTGCTGTAGACCCAGTAGCTGTGCTCGCTGTGTTTGAAGAGATCCATGTGAATGTGATGCTGTACATTTTAGTGTTTGGGGAATCGCTCTTAAATGACGCAGTTACTGTGGTGTTGTACCATCTGTTTGAAAGTTTAGCCCAGTTTGATGAAATTACTTATGCAGAGATTCTTAAAGGCTTGGCATCATTTTTCGTGGTCAGTATTGGAGGCACAACCATGGGTCTCCTGTGGGGCATAACCACAGCATTTATCACAAAGTTCACTGACCATGTTAGGGTTATTGAACCTATCTTTGTTTTTGTCATGAGTTATCTCTCGTATCTGACTGCAGAATTGTTCCACTTTTCCGGAATAATGAGCATTGTCACCTGTGCAATTATTATGAAGCCCTACGTGGAGCTCAACATTTCAAGAAAATCTCACACAACAATAAAATATTTCATGAAGATGATGAGTTCCAGCAGTGAAACTCTCATCTTCATGTTTCTTGGTGTTCGTGTTGTTACTGAAAAGCATAATTGGAACTCGGGCTTTGTGTTCGTTACGTTGGTTTTTATTTTAGTCTTTCGCGCCTTAGGGGTAGTTCTGCTGACGTGTCTAGCCAATTATGGACGGCTGAACAAGCTCAGTGCTGTAGATCAGTTTATCATGAGCTATGGTGGAATCCGAGGAGCGGTGTCTTTTTCTTTGGCTATCTTACTTTCCCAAAAACATTTCCCCCTCCGAGAGATGTTTGTGACTACTACTATTGTCATTGTTCTTTTTACAGTTTTCTTCCAGGGAATGACAATCAAGCCTCTGGTTCGAATTCTACACGTCAAACTCAGAGGCAAGGAAGAGATGAATATGTATGCAGAACTCAATGACAAGCTTTTAGATCATCTTGTGGCAGGAATCGAAGAAATAAGTGGTCATCGGGGGCACGGATATTACAAGGAAATGCTGGAATATATTCACAATAATTACCTGAGAAGATGGTTAATACGGGACGTTAATAGCTTGGTACACGATGAAGATATTTTACTGGCGTACAGAAGATTAGCTTACAAAGATGCGCTGACTCGGCTGGAAAGGGAAGGCAGCGGCGCAGCTTTATTCAAAAATTCCACAGAACCTGTATCCATCCAGCTACTTTGCAGAGGAGCTTTTGAGGCCTCCGCCATCACATCGACCGAACCCCCAGAGGAGGATGACGTGACCAAACCAATGTTAAGAGAGGGAACTCGCGATGTCCGCGTACCTGATGCTGTTCAAAAGGACTGGAGAGCAGAAGGAGTGTTGGATGACGATCTTGAAATACACGACCATTCCACAAGAAACTTAGACGATCTTCTTTCAAGAAACAGGGGAAGCTTTAGACACAGGAAAATGTTCAGAAATAACATAATCGACGACGATGAGGAATTCTTTCGAGACAGACGTTACCTTTTTCCGATGAAACCGAGGGAAACTGCGTATCAAGATCAGATTTTGGTGAATTCTAAGCCTGTTTATACCCATCACAGGCGCAAACACAAGCGCCACGGCCACAAACATCACAAGCGTCACAACCACTCGCTCAAGAAAAAGCTGTCCGCCATATTTGAAGAAACAGACGGGGGTGACCAGTATAGGAAGTCTTCTCCGACCCACGACAATACGGACAGAGACATTCCCAGCAGTGAAGACGAAGAGTGCGGTATAACATTTAGCGCTGGAACGCCGGGTCGAGAACCCTCGCTCGATGACAATGATGGAGGCGATAACCCGAGGAAATTTACAACTGGCGGGCAATCGTCAAGTGACACATCATCCGATGAAGAAGACGTCGAACCAAACAAAGGAAAACCCGCGAGGCTGAATGAAAGTGTTCCCTTGGACTCTGTTGTTGTGAATATTGAAGACGAAAACAAGGATGATGAAAAAGAAGAGGAGACCAGAATGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q61165	Sodium/hydrogen exchanger 1 OS=Mus musculus OX=10090 GN=Slc9a1 PE=1 SV=1
Q28036	Sodium/hydrogen exchanger 1 OS=Bos taurus OX=9913 GN=SLC9A1 PE=2 SV=2
P26431	Sodium/hydrogen exchanger 1 OS=Rattus norvegicus OX=10116 GN=Slc9a1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003187 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00999 all species →	Na_H_Exchanger	Sodium/hydrogen exchanger family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006153 all species →	Domain	Cation/H+ exchanger	Interproscan
IPR004709 all species →	Family	Na+/H+ exchanger	Interproscan
IPR018422 all species →	Family	Cation/H+ exchanger, CPA1 family	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10110 all species →	SODIUM/HYDROGEN EXCHANGER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006812 all species →	Biological Process	monoatomic cation transport	Interproscan
GO:0015297 all species →	Molecular Function	antiporter activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:1902600 all species →	Biological Process	proton transmembrane transport	Interproscan
GO:0006814 all species →	Biological Process	sodium ion transport	Interproscan
GO:0006885 all species →	Biological Process	regulation of pH	Interproscan
GO:0015385 all species →	Molecular Function	sodium:proton antiporter activity	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0015386 all species →	Molecular Function	potassium:proton antiporter activity	Interproscan
GO:0051453 all species →	Biological Process	regulation of intracellular pH	Interproscan
GO:0071805 all species →	Biological Process	potassium ion transmembrane transport	Interproscan
GO:0098719 all species →	Biological Process	sodium ion import across plasma membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074606987.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074606987.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

73TPM > 0

2Conditions

52.7Max TPM

23.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	38	18.89	43.54
all_coral_tissue · baseline	38	35	28.14	52.73

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.54
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.75
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.35
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.13
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.25
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.50
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.53
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.05
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.61
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.44
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.12
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.52
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.52
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.87
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.04
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.37
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.00
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.78
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.85
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.97
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.59
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.34
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.25
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.12
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.86
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.76
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.51
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.23
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.86
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.64
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.01
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.98
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.70
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.64
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.64
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.13
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.83
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.59
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.73
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.91
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.78
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.96
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.73
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.60
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.24
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.92
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.09
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.23
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.96
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.80
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.37
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.21
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.94
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.91
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.41
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.34
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.77
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.57
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.34
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.98
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.63
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.07
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.31
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.55
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.51
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.33
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.75
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.07
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.67
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.57
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.80
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.68
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.60
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.