Gene detail

Detailed information of XP_074607111.1 in Acropora palmata

Genomic Location: NC_133893.1:3078139...3100986
NR annotation: XP_044181462.1, replication factor C subunit 1-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074607111.1

ATGGACATCAGGTCTTTCTTTAGTCCGAAAGGGAAGGCTGCGAAGCCAGTCGTTTCAAAGTCGGATGAACAACGCGGGAAAGATTCCTCGAAAGCTAAGCTTTCGTCGAAGCAAGATGTTAAAAAATCCAAACAGGAAAGCAAGACATTATCTAGCAGTGAAGAGGATGAGGTAACAAAAAAGCATAATCATAAAGGAAGTCAGCAGAAAAAGCCAAGGAAGTTTATTGACTCAGATTCTGACGAAGACCCACTGCCTCCAAAAATGCGAAAGGCCACATCTGTGCCTAATAAGAGCCGTGCAAAGACCAAGAAAACTAGAAAACCTGCCAGCTCTGAGGAAGTGGATGATGAGGAAGTTGTTCCACAGAAGCTGAAAAAATCAGTCAAACAATCAGAAAAAAACAAGAAAAGCACAGATGTTGTTCTTGTCAAGGAGAGTCCTGAAAAACCCAAAGCCACTTCAGCACTGGATTTCTTTGGGTCTTTGCCTGTTGAAAGAGCTTCAAGAAACACCTATGCGAAAAAAAGGAAACGGCCCACCGATGAGTCAGAAAATGATGGACTGAACAACAGCATTGAGGAGGAATCTGTGAAAGGAACAGAGAAAAGAAAAAATGAGAATGTAAATGGGAAAACAGAGGAACAACCTTCAAAGAAAAGGAAAGAAGATCCTGGTTCCCATTTTGAGACAAAGAAACCTTCTCCTATAAAGAATAAGCCTGTGGATAAACCTCCCAAGACAACACCTGCCAGCAAGCTTGCAGCAAAAGCATCGACAAGTGATTCATCATCGAATTTTCCAGACTCTGTCCCGGAAACACCTGTACAAAAACCTAAAACCAAAAGCCCAAAGAAAACTGTCACACCAACCAAAGAGGGAAAAGGAATCAAAAAGGAATCGCCAAATATGAAAAAAGATCCAAAGAACTCGGTGGGAAGTGATGTCCCAAATGAAGTCCCACCTTCATTAGAAAAGAAAAAGTCAAATTATCGCAGTTTTATGGCGAGGGATGGGCCACGAGCTCTGGGATCTAAAGCCATTCCAGAGGGTGAGGAAAACTGTTTAGAGGGCCTTACGTTTGTTATCACCGGAGTTTTGGAAAGCATCGAGAGAGACGATGCTGTTGATTTGATTCAGAGATATGGGGGAAAGGTTACAGGATCCGTCAGTAAAAAGACAAGTTATGTAGTGGTTGGTCGAGACGCTGGTGAAAGTAAACTGAACAAGGCTCGTCAGTGTGGAACAACTCAGCTGGACGAAGAAGGCTTGTTCGAGCTTGTTAAAACAAGACCTGGAAAGCAAATCTCTTACGAGTCTCCTGCTGCGGAGAAGAAACCACGGAAGAAGCTAAAAAGTGACAGTTCTGAGACGAAAGAGGAAGTTCCTCGGGAAAAATTGGTGTTGGAAGGCAATTCGTCACAGCTAAGCCAGCAATCGACATCATCTCCTGCGACACAAACACCTTCAGCATCACCCACCTTGAAAGGAGAGGCAAGCTTGATGTGGGTGGACAAGTATCGTCCGCGCTCGATCAAACAGATTATTGGCCAACAAGGCGATAAGAGCAATATGCGAAAGCTGATGAACTGGCTGAGAGCCTGGGACGAGAACAGGAAGAAACCGCCATCTAAAGCATCGTTTTTTAAGAAAGACCAAGATGGCTCGTCTCTTAAGGCAGCGCTATTGTCCGGGTCTCCAGGAGTTGGAAAAACAACAACGGCCACTCTAGTTTGCGAAGAGCTTGGGTTTACCTACATCGAGATGAACGCTAGTGACACAAGGAGTAAAAAGACACTAGAAGAACACATCGCCCAATCGCTGAGCAACAAGACCATGGATGGTTTCCTACCTGGAATGAAGGCAGATCCGATGAAACATGTTCTCATAATGGACGAGGTCGATGGAATGGCTGGTAATGAAGATCGAGGAGGCATGCAGGAACTCATCTTGCTCATAAAGAACTCCAAGATTCCAATCATCTGCATGTGCAATGACAGGAACAGTCAGAAGATTCGCAGCTTGGCAAATTACTGCTTTGATTTGAGGTTTCAGAGGCCCCGTGTGGAGCAAATAAAGGGAGCTATGATGAGCATCGCCTTCAAGGAAGGTCTCAAGATTCCTCCCCAAGCGATGGAGCAGATTATTATTGGCGCAAATCAAGATGTCCGTCAGGTTCTTTACAATATGTCCATGTGGACAGCAAAGGAAAAAAGCCTGAGTTATGATCAAGCAAAGGCCGACGCTGCCAATGCGCAAAAAGACATCAAAATAGGTCCTTTTGATGCTGTAAGAAAACTTTTGTCACGAGCCGAGAGTTCTAAAATGAACTTAAACGAAAAGTCCGATTTGTTCTTCTGTGATTACTCGATCATGCCACTCTTTGTGCAAGAAAACTATCTTATGGTGGAACCTGGGGGAGGACGTGGCAATATAAAGAAAACCTTGGCGCTTATCAGCCAGGCGGCGGACTCCATCTGTGATGGGGATTTAGTTGGCAGGCTGATAAGAGAAAAAGGAAATTGGTCTTTGCTTCCAATGCAGGCCATGTTCTCGTGCGTGATCCCGTCTGGTTTGATTTGTGGCGGAATGGGACAGAGAATCGAATTTCCACAGTGGCTTGGGAAAAATTCCAAACACGGCAGATTAGACCGCTTACTGCAAGAACTGCAGAGTCACATGCGCCTGAGTACGTCTTCAAGCAAGCGATCCATGAATCTGGATTACATACCACATCTGAGGAAAGTTCTTACCTCACCGCTAATGACGCAAGAACCAGCTGAAATCAATCCTGGAGTTTCCAGGGTCATTCAAGTGATGGCGGATTATGACTTAACAAGAGAAGATTGGGAGTGCGTACTTGAAGTCGGTCAATTTGAGGGGCAGAAAGATCCTATCGCTTCTATTCAATCGAAGGTAAAAGCAGCCTTCACGAGGGCCTATAACAAAGAGAACCGCAAAACGCCCTACGTGATTCGTGCAGCGCCAAAGAAGGGCAGAAAAGGGGCGGCAGAACAAGAAAGCCAGGGCTTTGATGAAGAGGGGATGGAGCAACTGAGCGGGGAAATGGCGGGGGAAAATGATGATGACAACATTGAAAACGACGCCATGATAAAAACTACAAAGAGACAAGCCAAAGCTAGTGTAAGCGCACGAAAAAGTACAAGCCAGGAAACAGGGAAAGGCAAGGGGAAAGGAAAAGGGAAAAATAGAAAATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P35601	Replication factor C subunit 1 OS=Mus musculus OX=10090 GN=Rfc1 PE=1 SV=2
P35251	Replication factor C subunit 1 OS=Homo sapiens OX=9606 GN=RFC1 PE=1 SV=4
P35600	Replication factor C subunit 1 OS=Drosophila melanogaster OX=7227 GN=Gnf1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002560 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00004 all species →	AAA	ATPase family associated with various cellular activities (AAA)	Domain	Interproscan
PF00533 all species →	BRCT	BRCA1 C Terminus (BRCT) domain	Family	Interproscan
PF08519 all species →	RFC1	Replication factor RFC1 C terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036420 all species →	Homologous_superfamily	BRCT domain superfamily	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR003959 all species →	Domain	ATPase, AAA-type, core	Interproscan
IPR001357 all species →	Domain	BRCT domain	Interproscan
IPR008921 all species →	Homologous_superfamily	DNA polymerase III, clamp loader complex, gamma/delta/delta subunit, C-terminal	Interproscan
IPR012178 all species →	Family	Replication factor C subunit 1	Interproscan
IPR047854 all species →	Domain	Replication factor C, lid domain	Interproscan
IPR013725 all species →	Domain	DNA replication factor RFC1, C-terminal	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23389 all species →	CHROMOSOME TRANSMISSION FIDELITY FACTOR 18	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0006260 all species →	Biological Process	DNA replication	Interproscan
GO:0003689 all species →	Molecular Function	DNA clamp loader activity	Interproscan
GO:0005663 all species →	Cellular Component	DNA replication factor C complex	Interproscan
GO:0006281 all species →	Biological Process	DNA repair	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10754	RFC1; replication factor C subunit 1	-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074607111.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

68TPM > 0

2Conditions

35.2Max TPM

15.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	36	13.31	35.17
all_coral_tissue · baseline	38	32	18.03	33.08

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.17
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.66
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.14
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.62
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.54
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.42
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.83
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.69
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.18
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.53
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.43
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.42
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.36
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.12
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.53
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.43
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.00
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.19
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.27
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.92
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.79
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.55
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.46
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.96
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.63
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.64
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.58
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.26
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.13
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.05
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.47
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.25
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.00
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.64
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.62
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.79
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.08
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.37
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.11
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.32
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.45
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.32
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.81
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.47
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.07
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.64
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.23
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.20
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.15
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.97
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.91
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.15
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.83
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.64
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.14
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.58
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.47
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.89
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.54
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.39
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.96
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.38
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.33
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.91
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.74
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.45
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.94
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.65
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.