Gene detail

Detailed information of XP_074607128.1 in Acropora palmata

Genomic Location: NC_133893.1:3171634...3191731
NR annotation: XP_029202728.2, nuclear receptor coactivator 7-like isoform X2 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074607128.1

ATGTACAGCTTGATTAAAGGTTATATTTCAAGTGCAAACGAGGAAGAAGAGAAAGACCCACAAATAAGATCGAAAGCGGTCGAAAAACCGCAGACAAAAGCTAAGAAAGCTTTCCGCTCAACGAGAAGCAGGTCTGAAAGCTCCGCCCGATATCTGTCTTGGGAAAATGTTTCGTTCCTAGGGGGCGAAATTCGTAAAAGTGTCGTTAAGGGATTTCAGTGGATAACTTACCCTTCTCTTGAGTACGAGATGTCCTCGAAAGTTAAAAGAAAACCGCCACAGGGTACGAAGGAGTATTTGGTTGATATAAGTGATAGCCTGGCAAAGATTGCCCTCAGGTTTAACACGACTCCATCTGAGCTGACAAGAATCAATAAGCTGTCGTCGCGGATGCTCTTTCCAGGACAGTCATTATTTGTCCCTGATGACCAAGGTGACAAAAGTGTGATCAAAGAACCACCATCAGAACCAGTTGTTAAACCTCCACTGCCATTAAGCAACAAGCAGGAAAATGATCAGATAGCCCAAGCCAATGGCGACCACGAGACGGTCAAACTTACCAAAGATGTTTCTTGGGAGGAGGAAGAGGAAGAAGTCACAGAACATTATCTCAAAATTTATGCAAAGTACATTACAGATGGACAGGGTATTGCCAATGGCGTTCTTTTGATTACACCCCACTCGGTCATGTTCAAACCTAACGTGTCAGATCCGCTGGTGATGGACAGAGGTCAGGATACGTACAGCATAGCAACACGTATGACATCTGTTACTAGCGCGGCAATGTACACTGATATCGCGGCGATGGCTATCCATGATCCTCTGAAACCTGGAAGGTTTTATCTAGATGCTGCAACAGCGCAGTCTCTCAGTCGACAAAATAGCATCGACGCAGAAACAACATCTACATCAACTTGTGGAAATGTTGGCACTTGTCTCAAAGATATTTCGGAAGTATCGTTGTCCTCAAAGGAAAATGACAAGTCTTATACGGAAGGTGATCTGACGGATGGTGGGCAAAAACATGCAGACACATACATTTGTAGTCTGACGGATGGTGGGCAAAAACATGCCTATGATGCAGACACATACATTTGTAGTCCATCGGAGAATGCAATTTCTGATTCCGAAGATGTCAAAACGATTGTGCACGAGGTTTTGAACAATTTGATAAATCAAATCGCAGATTATGAACTCAGCCATTTGAATAAAAAAGCAGAGTCAGTCAAAGAATCCACAGTGAAACCGGTGCTGTTGCAAGACATTTACAACACTAGAGATGCTCATTCCATGTCACCCACGTCAGAGGATTCGGGAATCGGCTGCTCTGTGAACCAAAACGAGGAATCGAAAGACCAGGAACTTGCTCATCGTCCAGAACATGGACATGATTGCTTACATGAAGCCTCCGAAGATCAAGCTGCGATGAGTGATGGCAGAGTAGAAATTGATGACAACGAAGTGTCTTACAGTAATTCTGAACAATCGTTATTTTCTGCGCTTAGCAGTAATGTGAAGTATTGGCTTGGGCAAGGCGGCTATGACAAATCTGATGAAGACGAAGATGTTGTGCAGATAATCCCAAAGCCTGCCACACCTGTCAACCATCAACCGCTCTATCTCTGCCTACGAATTAGCAAGAAGCATTGGTGTATACACCACGCTCAAGGTGCCAATTTGCATCATGGTGGAGAGGACCTTTGGCATAGAGATCTCAAACGAAGGGAATACTGGTTTGCTATCCCCCCGTCAAGGACGGAACAAGTTTACAGATTCTTCCAGAAATGGTGTCCAAATATTCACAATGCTTTCGACAAAGATGATAGCGACGACAGCGAAATGTCACCCCAAGACTCTCACGCCATGGAAGAAGAGGGCCTAAATCTAGTGGAGTCATTCTATTCGGAGAATCCCTATCAAGGATCACACCCTCCGCTGACGAAAACACGCAGTGAAGGAGATGTTACGAAAGTTAAAAGAGGTTTTTATGGTTTTAAAACCAAACCTGGAAAAGCTGCGAAAGTGCTGACAAGCCCGAAACTTTCCCCAGAATTCGTTGAAGATGTTCTTCCTGAAATGGAATCCAAATCAGAAATTCTTGGGGAGGAGCATCTGAGAAAGCTGAACCGCATTCTTCCATCAAGGACCGTGGGCCACTGTTGGGAATTGGTGTACAGCACCTTCCAACATGGCTTCTCTCTTAGCACTCTGTACAGGAAAATGGAAGTCTATGATTCACCTGTCCTCCTGGTTGTCACGGATGACGCGCACCAAATTTTCGGTGCCCTGTGCTCGTGCCCCTTAAAAGTTAGCGAAGGATTTTATGGTACAGGGGAGTCCTTTCTGTACAAGTTTGACAGCGACACAGTCAAGACGTATCGCTGGACAGGAGAAAACAACTTTTTTATCAAGGGATCTAAAGACAGCTTAGCTATTGGAAGCGGAGGCGGTAACTTTGGTCTTTGGCTCGATGAAGATCTTTATCACGGTAGTAGCCATCCGTGCTCTACGTTCAGCAGCTCCCAGCTCTCTTCGCAAGAAGATTTCCTTTGCAGTGGACTGGAAGCGTGGACGTTCGTGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A8KBE0	Oxidation resistance protein 1 OS=Xenopus tropicalis OX=8364 GN=oxr1 PE=2 SV=2
Q4V8B0	Oxidation resistance protein 1 OS=Rattus norvegicus OX=10116 GN=Oxr1 PE=1 SV=3
B4F6Q9	Oxidation resistance protein 1 OS=Xenopus laevis OX=8355 GN=oxr1 PE=2 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002175 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07534 all species →	TLD	TLD	Domain	Interproscan
PF01476 all species →	LysM	LysM domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006571 all species →	Domain	TLDc domain	Interproscan
IPR018392 all species →	Domain	LysM domain	Interproscan
IPR036779 all species →	Homologous_superfamily	LysM domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23354 all species →	NUCLEOLAR PROTEIN 7/ESTROGEN RECEPTOR COACTIVATOR-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006979 all species →	Biological Process	response to oxidative stress	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K25442	NCOA7; nuclear receptor coactivator 7	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074607128.1 across 84 RNA-seq samples of Acropora palmata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

0TPM > 0

2Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	0	0.00	0.00
all_coral_tissue · baseline	38	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.