Gene detail

Detailed information of XP_074607458.1 in Acropora palmata

Genomic Location: NC_133882.1:21815743...21852619
NR annotation: XP_044181067.1, LOW QUALITY PROTEIN: potassium channel subfamily T member 1-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074607458.1

ATGAGGAACTCGTATCGACTGCGGGATTTGGTTTCGTCAGATAAAGGCGAGGACAAAGATAGGGTGTGTGTTGAGCATTATGTTCATGACAAGTCATTTAAAGAAAGAGTTAAATTCTATTTTGTAACTGATCAAAGATCTAGTATAAGACGACAGATATTGCGCTTTGTACTCAAGATTGTCTCATGTGTTTTATATGTTGTCCGTGTTTGCCAAGACACAGAACCACATAGGGCTGGAGGCTATGACTGTCCAGAAAATAGAACTGGTGCAGACTGGGCTTGTCCTGTATATGATATCAAGACAAACTATTATGCCTGGTCATTGCTGTGGGTCCATCGACCCTATCCACTCTGGATTATTCAGACAGTCATCGCTGTCTACAGCATCCTGGAGGCCCTTCTACTTTGTTACTTAACTTATAAGGGTGGAACTGTGCTCAATCAAATTGTGAATACAAGGGTTATCCCAGAGATATTACTTGGTTTACCCTTCTTTGCATCTATATTTTATATTCATCTAAGAAATTTGTGGTTACCATTGTTCTTAAATTGCTGGCTTGCAAAAAGTGCTCTGGATACAATGCTTAATGACCTTCACAGGCTTGTGCTTCGTCAACAGTCTGCATTGTCGCAAAAAGTTTTGGTAGTTTGTGGAACAGTTGTTTGTATCTTATTTACTGGGATCTGTGGTATCCATCACCTGGAGCGGCCAGTCCCTGAGCCATGGCTGTTTTTCGACTGTGTATGGTTCATAGTTGTGACGTTCAGTACTGTTGGTTATGGTGATTTCCAACCAGATGATGCGCCAGGAAAAATATTTGTTATTGTCATGATTTGCTGTGCTTTAATTCTGCTTCCAATTGAGTTCGAGCAGCTCGCTTTTCTTCTTGTGACACGGCAAAAGGAGGGAGGGACATTCAACCGCATGCTTGCTGGCTCTGAGAAGCATGTTGTGCTGTGTGCTACTACCCTTAGACCCACAATGCTGATTGACTTTCTGAATGAATTTTATGCTGATGTGAGATTACAGGATCATCATGTTGTCCTTCTTTGTCCATCCGAGCTTGATAGTACCTTGAGAATCTTGTTACAGGTTCCTGTGTGGTCTCAACGTGTCACATACTTAAAAGGATCAGCATTGATAGATGAAGACCTTATTCGGGCAAGGGTGGAGGATGCTGCTGGATGCTTTATACTCACTGATAGATATGCAGATGACAGAGAAGCAGCTGACAAACACACCATTTTAAGGGCATGGGCCATTCAGGACTTTGCACCAGCAACACCTTTGTATGTTCAGATTCTAAAGCCGGAAAATAAATTCCATGTCAGTTTTGCAGAGTATGTGGTCTGTGAGGATGAATTGAAGCATGCCCTTCTGGCAAGCAATTGTGTTTGTCCAGGAATCTCAACATTTTTCACTCTCCTACTGCACACACTTCATGAACAGAGAGGGTCAGAAGACTGGCATGAGATGTATGGGAAATGTGCTGGAAATGAAATTTATGACATTCGCTTAGGTGCAAGCAAGATGTTTCGGCCATTCTGTAAAAAGAGATTTAGCGATACTGCCTTCCATGTGCACAGGAAGTATGGGGTAACTCTTTTCGCTGTTCAAGCTGCAAAGAAAGGTTGGCGTATCTTGTTAAACCCTGGTCGTTCACATGTCATGGATTACAATGATCAGTGTTTTTACATCTCCATATCAAGTGAGGAAGACTCACACATCCCAGCCTACAAAGAACCCAAAGAGCCTTTGAGACTGTTCAGGGGCAGCTTTCGTGGCAATAAGGATTCTTTCATCACTGCAAGTTCTATTGCTCTTGAGTTACGAAGCGAGAATGCTGGATCAATTCATTTGGATGAGGTGCCTGCAAATGGTGTCAGCTATGCTGACTCCAGTGATCAAGTGACTTCGTCTCCATTGCTTAAAAGAGGAGAAGAAGAGAAAAGAGGACAATTGAAAGAAGTTGCCTTTAATGTTGGAGATTCTAGACGTTCATCAAATTCTTGCTGTCCTGGTTATGAATCTGACTCTGAAGATCAACAGGAGACAGATTTGCTTGATGACATTTCTAGAATACCAAGTTATGTGCCTGGAGTTCCACCATGCTCATTATACATTGGCCAAACTCCGATCAAGTGCCATCTCTTGAGTACTCCAAAGAAATGTTGCTGCTTAGGTCTTAGGGATGAGGAATGCCTGGACAGAAATCCTGATGACAGTATTCAATTACACCAGAGGCAGAATGGTGCTATCATAGTTGCATCTCCTGCAGCAGGTGCTGGACTGTACAACTTTATTCTTCCTTTGAGAGCTTACCAACGACCCAAGTGCACCCTCAAACCTATTGTGCTTCTTCTCAAAGAAAAGCCCAACCATGATTTCTTACTGGCAGTTTGTCATTTTCCAATGCTTTATTACATGATTGGAACCATTAATAGTTTGGATGATCTTCTCAAAGCAGGTTGTCTCCACGCGGACAGCATCGTTGTAGTTGGTTATCGGTCACATGGTCAAATATATGATGAAGATCACATGGCAGATGCCAACACCATTGTCGATGTACAGAGCATTTACAGATGCTTTCCAAGAGCAACCCTGATTGTTGAGCTAACACATGCATCAAACATGCGCTTCATGAAGTTCAATGCTGACATTTCTCTTCCACCTGACTTGAGGAGTGAATCCATGAGTAGTTTCAAGTCACGTAGTCTGAGGGAGAGTGTCAAGAAACGTATTAGAGAACAGAACAGGGATCATCTGAATTACATGTTCCGTGAGCCCTTTGCAGCTGGGCATGTTTTCAGCATGAGCATGCTGGATACTCTTCTATATCAGGCCTTTGTGAAAAAGTACATGATCCACTTGGTGAGACTGTTACTTGGTTGTGAACAGGCTTCAGGATCAGGATACCTGTCCTCTCTCAAAATAACAGAAGGTAGCATTTGGCTTGCAACTTATGGCAGACTGTTCCAGAAACTATGCTCGACAACTTGTGCAATTCCCATTGGACTGTATAGAACACACCTCCCTGAGGAGGACTTTGTGGATGCTTCTTCCAAGGGGAAAAAAAAAGAAGTGCGTGACATCTCAGGCATAATTGAAAACAGGATGAAAACTTTAAACATCATAGGAACTCCTGACATGAGGCAAAGACCAGGCAAATCGTTTGTGATTGTCAACCCTCCACCAGAGTTTGAACTAAAGTTGGAAGATGTCATTTACCTGATTCGTCCCTGCAATACTCAAACTGAGTCTGAAGAAGAACAAGAGGAACCAATGCAACCACTTGAACCTGGGATGTCCAGTAAAGATTTCCCCTCAACAACAGCACTGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8QFV0	Potassium channel subfamily T member 1 OS=Gallus gallus OX=9031 GN=KCNT1 PE=1 SV=1
D3Z649	Potassium channel subfamily T member 2 OS=Mus musculus OX=10090 GN=Kcnt2 PE=1 SV=1
Q6UVM3	Potassium channel subfamily T member 2 OS=Homo sapiens OX=9606 GN=KCNT2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002912 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07885 all species →	Ion_trans_2	Ion channel	Family	Interproscan
PF03493 all species →	BK_channel_a	Calcium-activated BK potassium channel alpha subunit	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR047871 all species →	Family	Calcium-activated potassium channel slowpoke-like	Interproscan
IPR013099 all species →	Domain	Potassium channel domain	Interproscan
IPR003929 all species →	Domain	Calcium-activated potassium channel BK, alpha subunit	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10027 all species →	CALCIUM-ACTIVATED POTASSIUM CHANNEL ALPHA CHAIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005228 all species →	Molecular Function	intracellular sodium-activated potassium channel activity	Interproscan
GO:0005267 all species →	Molecular Function	potassium channel activity	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0015271 all species →	Molecular Function	outward rectifier potassium channel activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0016021 all species →	Cellular Component	membrane	Interproscan
GO:0071805 all species →	Biological Process	potassium ion transmembrane transport	Interproscan
GO:0006813 all species →	Biological Process	potassium ion transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K04947	KCNT2, KNA1.2; potassium channel subfamily T member 2	-	Ion channels	ko04040	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074607458.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

53TPM > 0

2Conditions

18.5Max TPM

6.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	29	5.19	15.05
all_coral_tissue · baseline	38	24	7.23	18.50

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.05
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.60
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.51
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.07
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.05
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.02
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.78
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.75
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.56
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.56
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.50
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.60
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.57
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.05
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.89
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.25
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.91
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.86
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.63
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.01
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.80
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.94
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.88
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.82
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.66
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.65
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.59
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.20
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.07
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.50
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.75
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.45
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.07
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.70
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.54
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.13
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.03
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.13
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.56
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.47
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.44
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.43
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.27
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.86
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.26
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.12
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.78
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.99
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.32
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.43
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.36
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.23
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.14
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.