Gene detail

Detailed information of XP_074607672.1 in Acropora palmata

Genomic Location: NC_133893.1:1055444...1065733
NR annotation: XP_044181485.1, F-box only protein 10-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074607672.1

ATGCCGGAAAAAGAATCTTTGCTACCGCAAGAGCTATGGCGAGTGATTTTAAACCATTTGTCTGTGAGAGATCTGTGTCGCTGTTCACAAGTTTGCCAAGAATGGAGGGAATTAGTAAAGAGCTTAGATTCAACGCGTTGGAAAGAGCTGTTTCTTGCTTCCAAGCGATGGAAACATCCAAATTGGCCGAACTACACACAGAAGGAACCATCTTCGTGGAAAGATACTTACAAGATTCATTATTTAGCTTCAAAACAATGGGTGAACCATAGCGTAGAAGTTCGGTGTGCACCCTGTGCATATTTATTTAGGAGAAGATTAGAACATCGAAAGGTTTTGCGTGTGGGACAAGGAAGAGTATTCCGTACCATCAAGAGCGCAATTTCTGCTGCCGCTCCGTTTGATTGTATTATGCTACAAACCGGTGCTTATGAAGAACAACACGTTTTGAGTGTGAAATTTCCAGTCGAAATCTGCGGTGAAGGAGAACTTGGCGACGTTCTTGTTCAAATAGCAGTGGAACAACAAGCTTCCTCTTTGCGAATTCAGAACCTCATTCTTCAACCTGGGCCTCAGCGATCGCAAACTTCACTCCCTACAATTTTAAAGGTAAGCACTGGACACGTTCAAGTCGATAATTGTATTATCGATCAGGGACACATTCAAGTGTCATCCCCTGGCAGCATCGTCATTCGTTACTGTACTTTCAAAAATGCTTTTGTCACATTACGATCTGTCGGCTTCAGTAGGATTGAAAACTGTCAGTTTTGTTCAGATGAATCGTCAGCAGTTGTCATAGAAGGCCTTCCACCGATTACAAGGCAAAGACCAATCTCACGACCTTTGGATAATTGGATGTTGTCAAATGGTATTAGTTCACTGGGATTAGAAGATTTGTACGACTTGTCTGTGATTGAGAATGATACTAAGAAAGGTGCAAAGGTGATTGGTAATGGCGTCGGATCTCCAAATGACATTTTCCCTGTCATAACAATGAAACCTCTGGAATGCCACTTAAAAGCAAACAGTGAAAACCAGATCAATGTTGTAACAAACAGTGTTTCGCAATCTAAGAATCCCCTTGGACTTGGATGTCAGACACAAAGGCATTACCTAGATACCCAGTGCCGTGAGGTGGTCAGATCCATACACGGCTGTATAATTAGAAACAACCACTTCGCGGCTGGTAAGGGAGCTGTGCTGGTTCGCAGAAGGGGACATGCATGGATTGAGGGAAATGAAATCAGCCATTTATCGCATGGTGTCCGGTGTCTCACAGGTGCTAAAGTTGTTATTTTAAAGAACAGAATTCATGACTGCAGTACATCAGGGATTTTTTTCCGAGAGAGGTCCACCGGTTTGGTAGCTGGAAACCACATTTACTCCAACAAAGAAGCTGGCGCTGACATTCGTAGTGGTTCTGACCCGATATTACAACACAATCACATTCACAGTGGAAAAAGATCTGGGGTTGTCATTTTGGATCGTGGCAAAGGAATCATTCGAGACAATGACATTTATGACAATAAAGAAGCTGGTGTCTACATTCTTTATCGTGGAAATCCAGTAGTCAAACGCAATAGGATCTGGTCAGGCCATGCAGCTGGTGTTGCTGTGACAGAAGAAGGCAAGGGTCAAATTCTCTTCAATGATATCTATGGGATGGAATGGGGTGGTGTGGACATCAGAAATGGTGGCAACCCTGTGGTGTCAAACAATTGGATAAGGGACGGACATGCTGATGGAATTGTCATTGGAGAGGGTGGAAAAGGAATCATAATGGATAACGACATTAGAGGCAACAGTGGCTGTGGTGTGTGGATCCTAACAGTGTCTAAACCACTAATCAATGGCAACAGAATTGCAGATTGTGGAGACAGTGGAGTTGCACTTGTCAGCAACAGTGACCTTCACCATGACAACCAACAGCTCAACTCTCAGTTTTTGCAGTCAGAACAAGAGGAGCAGCAACTGCAGCCATTGTTCTTTGATGAAGATTTGTCATCCACATCAAACATGGATGATCATGAGCAATCAATTGAACTGAATGGCCTTCGACCAGATAAGAACTATGCTTGTGTAGACAACAACACAATATTCAATAACGCTGGCCATGGAATCCACTTTTCTGGCAGTGAAGGGTTGCTGATACGGGGCAACAATGTGCACAATAATGAAGGCTGTGGAATCAAAATTGCTAAGCCAGCTGAGATTGTCATTCAAGACAACAGTGTTTGTAGGAACAGAAGTTCAGGCATCAGCATTGAAATTGCTTGCAGTGCTAATGTTAGCGGGAATGGTATTTATGGTAACCAAAAACATGGAATTGTGGTGTCTGGAAAAGGATTAATCAAGGAAAATGATGTGTTTTGCAATGCAATGAGTGGTGTTGAACTGCGAGGTCCCGGAGATCCTTATATCACGCGAAACCGGATTCAATCCACGGACAATTATGGAGTGCATATCCTGGAAAATGGCCGTGGTTATGTTGACAGTAACGATATTTACCAGTGCAACATGACAGGTCTATACCAAAACCCTGACAGCACAGTGTTGGTCATAAACAATCGTATAATACCTGTGAACACCAAGGATGGTCATCAAGTTTGTATCGTCAATGAAGGTACCACCGACTGCAGGCATGATCCAGTGGGCCTGGATCTAGACTCACCTCCACGTCCTTTACTTCCAAATAAGGAGAACAAGTTTCCACGACCGCCAGTGTCGCAAATGTCATCGTTGTCATTAGGAAACGGTCACATTGTGACAGCAATAACAGCTTGTCATGGACGAAGTCGCTTTTGTGTTATTTCTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9UK96	F-box only protein 10 OS=Homo sapiens OX=9606 GN=FBXO10 PE=1 SV=3
Q7TQF2	F-box only protein 10 OS=Mus musculus OX=10090 GN=Fbxo10 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006012 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13229 all species →	Beta_helix	Right handed beta helix region	Repeat	Interproscan
PF00646 all species →	F-box	F-box domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011050 all species →	Homologous_superfamily	Pectin lyase fold/virulence factor	Interproscan
IPR012334 all species →	Homologous_superfamily	Pectin lyase fold	Interproscan
IPR036047 all species →	Homologous_superfamily	F-box-like domain superfamily	Interproscan
IPR001810 all species →	Domain	F-box domain	Interproscan
IPR006626 all species →	Repeat	Parallel beta-helix repeat	Interproscan
IPR039448 all species →	Domain	Right handed beta helix domain	Interproscan
IPR022441 all species →	Repeat	Parallel beta-helix repeat-2	Interproscan
IPR006633 all species →	Domain	Carbohydrate-binding/sugar hydrolysis domain	Interproscan
IPR051550 all species →	Family	SCF Complex Subunits and Alginate Epimerases	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22990 all species →	F-BOX ONLY PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0006511 all species →	Biological Process	ubiquitin-dependent protein catabolic process	Interproscan
GO:0042981 all species →	Biological Process	regulation of apoptotic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10296	FBXO10; F-box protein 10	-	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074607672.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

62TPM > 0

2Conditions

21.4Max TPM

7.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	32	5.60	16.05
all_coral_tissue · baseline	38	30	9.99	21.37

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.05
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.71
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.36
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.92
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.82
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.46
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.92
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.60
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.39
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.02
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.72
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.66
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.43
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.15
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.85
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.74
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.85
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.50
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.01
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.65
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.58
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.46
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.98
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.76
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.72
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.31
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.78
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.78
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.16
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.12
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.10
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.94
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.37
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.77
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.06
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.02
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.60
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.78
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.25
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.07
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.96
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.86
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.32
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.99
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.64
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.35
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.99
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.71
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.26
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.03
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.75
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.45
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.99
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.70
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.43
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.02
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.72
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.14
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.10
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.85
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.70
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.82
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.