Gene detail

Detailed information of XP_074608151.1 in Acropora palmata

Genomic Location: NC_133893.1:5428616...5441119
NR annotation: XP_044166133.1, H/ACA ribonucleoprotein complex non-core subunit NAF1-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074608151.1

ATGGAGTATCTTGAGAATCCAGGAATGCAAATAATGGAGGAAAACCACGACGTTAAGGAAAGCGTTTTGAGTCCGCAGCTTTCTGCTGTTCCCAGTCTAGAACAATCGGTGGTGACTGGCAGTTCTTCTGGATCTATTAATGGAAAAAATGAGAAGAGGCTCGCTGAACAAGATTCAGTTACAAATGCACCAGCTTGCACGTCAGGAGTTGCCGAAAATAAAAGCGTTATTTACCATTTACATGATACCGAAGTCAGCAAGTTAAGCTCAGAAGCCGCTAGTGCTTCATCATCAGAAAATAAAACAAGCTCCAAAATGTCTGAAGAGCTCATACATTCAAAGAATGGGCATTTTGGAGATGGGTACTGTGAAGAACCGGGAAACATTGACAGTGTTGAAAGTGATAATATTTTCCCTTCCAAGCCAGCGAAAGCTGTTCACTTGAAAAATCAGCAAAATGATATTGTCAATGTAAAGTTGTTGGAGGACGAGGCAAATGTTAAAAATCTTACTCTTGCAAATGGTTCAGAAACCAGTACGTATTCATGTTTAGAAAATGAGAAGTCCTCAGAAATTTCTCAGGGATCTGTTAGTTTGAATGCAGCTTCTGTCGTGAATGGGTACTGCAGCCAAGGTTTGCAGAGCAACAAGGAGATGGACATCTGTGAAAATCTTACCTCTGTGTCAGAGAAACAGAACGTAGAAAACCAGAAAAGCCATAGTTACTCTGTAAACGTAATGATGGACATATCAAAGAATGAAGAACATGCAACTGAAACGCAAGTGACAATGTCAACGGAGAATGTGGAACAAGCATTTGAAGGCACAACGCCTAGTATGGAACATAAAATGACAAATCCTTCTTGTGCCCAAAGTACTGGTACACTTCCTGATTCAGACACAGCTAATGATGTTTATGTTATGGAAAAAATAGACAAAGTGCTAGATGTTCTCTGTGAGGAGAATCCAGAAAAGAAGGAAAATGTGGAACAGGGCAACTCTTCTTTGAGTGAATATTCTTCAGACTCCGATGACGAGAGCTCATCAAGTGAAAGCTCAACAAGCTCTGATTCCAGCTCTAGTGAAGACTTAGAAAACATCAGGAAAGAAATTGAAAAAGAGGAAGAAAAATTGCAAGCTGGTCCACCAAAGACAAAAAGTGAAGTTTTGATAAAGGAGCTTCCTGAACTGCCAGACCTAGATATTAACTTAGAAAACGATACTCAACTTGTGGAACTTGGACAAGTCTTTAGTATTGTGGAAATGTTAGTTATTATAAAAGCCTTTCCTCAAACACCCGCTTTGGATTCAGATAGCATTCTGTTCTTGGAGAACAGATCTTGCCTGGGGCTGGTTTTTGAGACATTTGGTCCAGTACAGACACCATTTTATTCTGTGCGATTTAACAAGGAGTCAGATATCAATGACAAAGGTGTTTGCAGGGGAGATAAAGTGTTTTATGCTCCAGACATCATGGAGTATTCCCACTATGTGTTTGTGACACAGCTGAAAAAGTTGAAAGGATCTGATGCTTCATGGGAACACGATGAAGAACCTCCGCAGGAGCTGATAGAATACTCAGATGATGAAGAGGAAGCAAAAGCAAAGGCCAGCAAGAGAAAGGAAAGGATGGCTAAGAGTGGGTCTTCAGAAAATGCTTCTTCAGAGAAAGTGGATGAAACAGGAACACCCCTCCAGCAGGGATGGGAGAAAAGTAGCAGGAAAAGAAGTTGGCAGAATCAAGCAAAAGCTCATCCTGTTGATCAGAAACAAAATGCTGTAGTGATACAAAGAGGCCCTCCACCTCGACCTGACAGTGGTCCTAGGTTTGCCCCACAAGCAGTGGGAAGACCTTTTATGGACCATTTCACTTCAGGAGCACAACAATTTGGAATACGGCCCATGGCACCACCTGGTGGAGGGACTGCAGGGGGATTTTCTCTCCGTGGTCCACCTTCCGGAGGCCCTTTATATATGGTTCCTCCACACACAAGGCAGTTCCAAGCAAGGCCCCCTGAAGGATCTAGTTTCCAAGGGAACTATCCCGTAGGACAACCCTCTGGGTTTACTTTAAGGCATTGTCTGCCTCCCCGGCAAGGTTTTTCTGGACCCTTATCGGGAGGGCCTTGTTTCCAAGGACCTTGGCAAGTCAGTGCTCCCTCTGGGTTCTCCTCACAGCATCCTATGCCTCAAGGTTTTCCAAAACCTAGTTTCCAAGGACAAAATTACATTGGTATGCACCCACCACGCCCTTGGCCTCATAATTTGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q3UMQ8	H/ACA ribonucleoprotein complex non-core subunit NAF1 OS=Mus musculus OX=10090 GN=Naf1 PE=1 SV=2
Q9VJ62	H/ACA ribonucleoprotein complex non-core subunit NAF1 OS=Drosophila melanogaster OX=7227 GN=CG10341 PE=1 SV=2
O14360	H/ACA ribonucleoprotein complex non-core subunit NAF1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) OX=284812 GN=naf1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004507 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04410 all species →	Gar1	Gar1/Naf1 RNA binding region	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR038664 all species →	Homologous_superfamily	H/ACA RNP complex subunit Gar1/Naf1, Cbf5-binding domain	Interproscan
IPR040309 all species →	Family	H/ACA ribonucleoprotein complex non-core subunit Naf1	Interproscan
IPR007504 all species →	Family	H/ACA ribonucleoprotein complex, subunit Gar1/Naf1	Interproscan
IPR009000 all species →	Homologous_superfamily	Translation protein, beta-barrel domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR31633 all species →	H/ACA RIBONUCLEOPROTEIN COMPLEX NON-CORE SUBUNIT NAF1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000493 all species →	Biological Process	box H/ACA snoRNP assembly	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0005732 all species →	Cellular Component	sno(s)RNA-containing ribonucleoprotein complex	Interproscan
GO:0042254 all species →	Biological Process	ribosome biogenesis	Interproscan
GO:0001522 all species →	Biological Process	pseudouridine synthesis	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14763	NAF1; H/ACA ribonucleoprotein complex non-core subunit NAF1	-	Ribosome biogenesis	ko03009	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074608151.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

51TPM > 0

2Conditions

12.7Max TPM

4.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	27	4.11	11.85
all_coral_tissue · baseline	38	24	5.35	12.65

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.85
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.19
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.03
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.83
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.24
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.01
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.93
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.73
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.28
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.10
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.06
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.55
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.18
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.92
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.74
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.38
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.96
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.56
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.41
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.32
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.27
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.08
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.48
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.31
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.81
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.57
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.20
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.65
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.26
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.04
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.47
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.26
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.22
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.16
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.80
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.49
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.36
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.35
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.11
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.94
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.67
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.33
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.02
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.75
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.58
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.93
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.55
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.52
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.68
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.25
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.90
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.